ID: 1056705368

View in Genome Browser
Species Human (GRCh38)
Location 9:88948057-88948079
Sequence CAGAATTAAGTGAAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056705365_1056705368 -2 Left 1056705365 9:88948036-88948058 CCTAATTTAGGCATGAGTCAGCA No data
Right 1056705368 9:88948057-88948079 CAGAATTAAGTGAAGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056705368 Original CRISPR CAGAATTAAGTGAAGGAGGT AGG Intergenic
No off target data available for this crispr