ID: 1056713522

View in Genome Browser
Species Human (GRCh38)
Location 9:89010372-89010394
Sequence TCTCATGGGGGTGCTCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056713522_1056713529 -3 Left 1056713522 9:89010372-89010394 CCACAATGAGCACCCCCATGAGA 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1056713529 9:89010392-89010414 AGAGGCCCAGCCGGCCTCCGTGG 0: 1
1: 0
2: 2
3: 29
4: 212
1056713522_1056713530 -2 Left 1056713522 9:89010372-89010394 CCACAATGAGCACCCCCATGAGA 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1056713530 9:89010393-89010415 GAGGCCCAGCCGGCCTCCGTGGG 0: 1
1: 0
2: 0
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056713522 Original CRISPR TCTCATGGGGGTGCTCATTG TGG (reversed) Intergenic
900143906 1:1149889-1149911 CCCCATGGGGGTGCTGAGTGTGG + Intergenic
902651325 1:17839497-17839519 TCTGATGAGGGTGCTCTTTCTGG - Intergenic
908826754 1:68140852-68140874 TCTGTTGAGGCTGCTCATTGTGG - Intronic
910451189 1:87347351-87347373 TCTAATGGGGATGCTCTGTGTGG + Exonic
913663508 1:121026592-121026614 TCTTATGGGGCTGGACATTGTGG + Intergenic
914014900 1:143809871-143809893 TCTTATGGGGCTGGACATTGTGG + Intergenic
914162922 1:145151344-145151366 TCTTATGGGGCTGGACATTGTGG - Intergenic
914653520 1:149718410-149718432 TCTTATGGGGCTGGACATTGTGG + Intergenic
916190283 1:162171401-162171423 TGTCATGGGGCTGCTCATCATGG + Intronic
920203862 1:204277345-204277367 TCTCCTTGGGGTGCTGAATGGGG - Intronic
1063498204 10:6529432-6529454 TGTCATGTAGGTGCTCAGTGAGG + Intronic
1066263916 10:33756498-33756520 TGTCATGGGAGTGGTGATTGTGG - Intergenic
1070515530 10:77202263-77202285 TCTCAAAGGAGTGCTAATTGAGG + Intronic
1070680786 10:78447733-78447755 TTTCCTGGGGATGCTAATTGAGG - Intergenic
1070810634 10:79296097-79296119 TCACATTGGGGTACACATTGGGG + Intronic
1075970668 10:126649721-126649743 TCTCATGGGGGTTATGGTTGAGG - Intronic
1076437514 10:130456227-130456249 ACTCATGGGGAGGTTCATTGGGG - Intergenic
1076482916 10:130796562-130796584 TCTCAAGGGGGTGCTCAAACAGG + Intergenic
1076723226 10:132401802-132401824 TCTCATGGGGTTGCTCAAGGAGG + Intronic
1077808807 11:5616703-5616725 TCTCATGGGGTTGATGTTTGAGG + Intronic
1079922148 11:26446410-26446432 TCTCATGGGGCAGCTCAAAGTGG - Intronic
1082004127 11:47410319-47410341 CCTCATGGTGGGGCTCAGTGGGG + Exonic
1082826750 11:57585479-57585501 ACTCATGGGGATGTCCATTGTGG - Intergenic
1084328549 11:68416161-68416183 TCTCTTGGGGGTGCGCTATGGGG - Intronic
1084522834 11:69675070-69675092 TCCCTTGGGCGTGCGCATTGGGG - Intronic
1091529148 12:1338025-1338047 TCTCATGAAGGATCTCATTGGGG + Intronic
1092704298 12:11267365-11267387 TCTTGTGGGGGTGGTCCTTGTGG + Exonic
1092716450 12:11393950-11393972 CCTTGTGGGGGTGCTCCTTGTGG + Exonic
1094867792 12:34559071-34559093 TGACATTTGGGTGCTCATTGAGG - Intergenic
1095135158 12:38592053-38592075 TGACATTTGGGTGCTCATTGAGG + Intergenic
1095699694 12:45178017-45178039 TCTCATGAAGATGCTCATTGAGG + Intergenic
1096354603 12:50929753-50929775 TCTCAAGGGTGTGCTTAGTGTGG + Intronic
1102246927 12:111361976-111361998 CCTCATGGTGGTGCTCCTGGTGG - Exonic
1103589234 12:121979471-121979493 TCTCCTGGGGGTGCTCACTGCGG + Intronic
1104359914 12:128123079-128123101 TTTCATTGTGGTGGTCATTGAGG - Intergenic
1106465701 13:30012797-30012819 ACTCATGTGAGTGCTCACTGTGG - Intergenic
1106906472 13:34414665-34414687 TTTCATAGGGGTGCTCCTTCGGG - Intergenic
1107666941 13:42700233-42700255 TCTGATGGGGGCTGTCATTGTGG + Intergenic
1108149636 13:47520160-47520182 TCTCCTGGGAGTGCTCTTTAAGG - Intergenic
1112427515 13:99316612-99316634 TCTCATGGCTGGGCTCCTTGAGG - Intronic
1117278453 14:54213436-54213458 TCTCTTGGGTGTGCTCCTTCAGG - Intergenic
1118234341 14:63987443-63987465 TCTCCTGGGAGTTATCATTGAGG + Intronic
1121698866 14:95936508-95936530 TCTCCTTGGGAAGCTCATTGGGG - Intergenic
1121946494 14:98127857-98127879 AATCACTGGGGTGCTCATTGGGG + Intergenic
1122408112 14:101512327-101512349 TCTCTCGGGCGTCCTCATTGGGG + Intergenic
1126690655 15:51286645-51286667 TCTTAAGGGGGTACTCATGGTGG - Intronic
1127789111 15:62382534-62382556 TCTCATGGTGGTTCTCCATGTGG + Intergenic
1135285252 16:21187631-21187653 TCCCCTGGGGGTGCTGGTTGAGG - Intergenic
1136250131 16:28998937-28998959 GCTCATTGGGGTGGTCAGTGGGG + Intergenic
1137748863 16:50843268-50843290 TCTGATGGGGATGCTAATGGGGG - Intergenic
1141266859 16:82505706-82505728 TCCCATGAGGGTGAGCATTGTGG + Intergenic
1141903025 16:87005191-87005213 TGTCATGTGGGTGCTCATGGAGG - Intergenic
1142896213 17:2980773-2980795 ACTCAAGGGGGTGCTCAATCTGG - Intronic
1147841163 17:43372455-43372477 TCACATGGGGGTCTTCTTTGTGG + Intergenic
1148548085 17:48531956-48531978 TCACCTGGCTGTGCTCATTGTGG - Intergenic
1153705378 18:7739698-7739720 TCTTATGGGCCTGCTCCTTGGGG + Intronic
1153979187 18:10294882-10294904 TCACATGGGGATCCTCATGGAGG - Intergenic
1161279151 19:3435629-3435651 TCTCATTGGGGTCCTTCTTGAGG + Intronic
1161726271 19:5931067-5931089 TCTCACGGGAGTGATCCTTGAGG - Intronic
1164235595 19:23330384-23330406 TCTTATTGGGATGCTCATTTTGG + Intronic
1164399068 19:27890440-27890462 TCTCCCTGGGGTGCCCATTGAGG - Intergenic
1164556927 19:29260330-29260352 CCCCATGGGGCTGCTCATGGAGG + Intergenic
1164579277 19:29424521-29424543 TCTCAGAGGGGTCCTAATTGTGG + Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1166410805 19:42554446-42554468 TCTCATGGAGGAGGGCATTGGGG + Intronic
925507144 2:4579833-4579855 TGTCATGAGGTTGCTCATTGTGG + Intergenic
930013002 2:46951943-46951965 TCTGAGGGGGATGCTCTTTGGGG + Intronic
932806962 2:74792550-74792572 TCTCATGGGGGTGGTGATGGTGG + Intergenic
935338342 2:102037066-102037088 TCTCATGTGGGTCTTCCTTGTGG + Intergenic
936868075 2:117099802-117099824 TCCCATTGGGATGATCATTGTGG - Intergenic
941446586 2:165608568-165608590 TCTCATGTATGTGCTAATTGTGG + Intronic
946674236 2:222141363-222141385 TCCCATGGGGCTGCTGTTTGTGG - Intergenic
1170993842 20:21332168-21332190 GCTCATTTGGGTGCTCATTTGGG + Intronic
1174365426 20:50053537-50053559 TGTAAGGGGGGTGCTCCTTGAGG + Intergenic
1174944995 20:54975106-54975128 TTTCATGGGGGTCCTCAGTGGGG + Intergenic
1175873668 20:62219832-62219854 GCTCATGGCGCTGCTCATCGTGG - Exonic
1176189191 20:63799765-63799787 TCTCATGGGGGAGCTTGCTGTGG - Intronic
1177703280 21:24666514-24666536 TCACATGGGGGTGATGAATGAGG - Intergenic
1178565244 21:33677887-33677909 TCTCATGTGGGTGTTTATTGTGG + Intronic
1180855285 22:19041432-19041454 TCTCATGGGGATGCCGAATGTGG - Intronic
1182136324 22:27907255-27907277 TCTCATGGGGCTGCACCTTTAGG + Intronic
1185247053 22:49778574-49778596 TCCCATGGGGGACCTCATCGGGG - Intronic
954351580 3:50048619-50048641 TCTCCTGGGGGTGGTCATAAAGG + Intronic
954426123 3:50444009-50444031 TCTCATGAGGGTACTTATGGGGG - Intronic
957206490 3:77205348-77205370 TCTGCTGGGGGTGCTCAGAGAGG - Intronic
978030108 4:103930866-103930888 GCTCATGGGCGTCCTCATTGTGG + Intergenic
980969239 4:139554169-139554191 TCTCAAGGGGGTTCTGATTTTGG + Intronic
981490139 4:145330908-145330930 TCTCATTGGCGTTCTCATGGTGG + Intergenic
982727270 4:158918900-158918922 TCTGGTGGTGGTGTTCATTGTGG - Intronic
989504710 5:42214690-42214712 TCTCATGGAGGTACTCATAGAGG - Intergenic
997097526 5:130929782-130929804 TATCATGTTTGTGCTCATTGAGG + Intergenic
999999221 5:157121063-157121085 TCTCCTGGGGATGGTCCTTGGGG - Intronic
1001715363 5:173811022-173811044 GGTCATGGTGGTGATCATTGTGG + Intergenic
1005421307 6:25654255-25654277 TCTCATGTGAGAGCTCAGTGAGG + Intronic
1006712337 6:36084827-36084849 TCTCATGGGGTAGCTTACTGGGG - Intronic
1011743798 6:90389345-90389367 TATCATGGGGGTGCTCCAGGTGG - Intergenic
1013643782 6:112114921-112114943 TCAACTGGGGGTGCTCTTTGGGG + Intronic
1013669098 6:112378716-112378738 TTACATGGGTGTGCTCATTTTGG - Intergenic
1014274597 6:119373421-119373443 TCTCTTGGGGGTGCTGTTTAAGG + Intergenic
1017452215 6:154564753-154564775 TCACATTGGGGTGCTGATTAGGG + Intergenic
1017533782 6:155325314-155325336 TGTCATAGGTGTACTCATTGTGG + Intergenic
1019398371 7:835896-835918 TCTCATGGGGGTGTTGGCTGTGG + Intronic
1025598818 7:62968402-62968424 TTACATTTGGGTGCTCATTGAGG + Intergenic
1026871791 7:73857213-73857235 TCCCATGGGGCTGCCCATAGGGG + Intergenic
1034499757 7:151441975-151441997 TCTAATGGGGGCGCTGATTGTGG - Intergenic
1035327021 7:158071865-158071887 TCATATGGAGGTGCTCATGGTGG + Intronic
1035327053 7:158072010-158072032 TCGTATGGAGGTGCTCATGGTGG + Intronic
1036687400 8:10921111-10921133 TCTCATGTGGGAGCCCACTGGGG - Intronic
1042344902 8:67717492-67717514 TCTCTTGGGAGTGCTTAGTGGGG - Intronic
1046577754 8:116052289-116052311 TCACATGGCATTGCTCATTGTGG + Intergenic
1056713522 9:89010372-89010394 TCTCATGGGGGTGCTCATTGTGG - Intergenic
1058829619 9:108803863-108803885 TCTTTTGTGGCTGCTCATTGAGG - Intergenic
1060594615 9:124840623-124840645 CCTCATGGGGGAGCTGATTCTGG + Intergenic
1061999938 9:134210835-134210857 TCCACTGGGGGTGCTCATTCTGG - Intergenic
1062553909 9:137105430-137105452 TGACATGGGGGTGCCCATGGGGG - Intronic
1203790522 EBV:149170-149192 TCTCATGATGGTGCTGATAGAGG + Intergenic
1190920444 X:54846500-54846522 TGTCTTGGGGTTGCTCTTTGTGG - Intergenic
1191264180 X:58366732-58366754 ACTCATTTGGGAGCTCATTGAGG - Intergenic
1192405836 X:70885366-70885388 TCTCATGAAGATGCTCACTGAGG + Intronic
1200976383 Y:9216012-9216034 TCACATGGGGGTGCTGGCTGTGG + Intergenic
1202134787 Y:21650518-21650540 TCACATGGGGGTGCTGGCTGTGG - Intergenic