ID: 1056715378

View in Genome Browser
Species Human (GRCh38)
Location 9:89024207-89024229
Sequence CCTTGAAGCCCTTTCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056715371_1056715378 16 Left 1056715371 9:89024168-89024190 CCCTGATGTGTAAAGGGCATGGT 0: 1
1: 0
2: 0
3: 6
4: 134
Right 1056715378 9:89024207-89024229 CCTTGAAGCCCTTTCTCTCCTGG No data
1056715369_1056715378 17 Left 1056715369 9:89024167-89024189 CCCCTGATGTGTAAAGGGCATGG 0: 1
1: 0
2: 3
3: 14
4: 115
Right 1056715378 9:89024207-89024229 CCTTGAAGCCCTTTCTCTCCTGG No data
1056715373_1056715378 -10 Left 1056715373 9:89024194-89024216 CCCAAGCCATTACCCTTGAAGCC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1056715378 9:89024207-89024229 CCTTGAAGCCCTTTCTCTCCTGG No data
1056715372_1056715378 15 Left 1056715372 9:89024169-89024191 CCTGATGTGTAAAGGGCATGGTC 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1056715378 9:89024207-89024229 CCTTGAAGCCCTTTCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056715378 Original CRISPR CCTTGAAGCCCTTTCTCTCC TGG Intronic
No off target data available for this crispr