ID: 1056715749

View in Genome Browser
Species Human (GRCh38)
Location 9:89026808-89026830
Sequence GTCCAAGGGCCCAGGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 559}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056715749_1056715753 3 Left 1056715749 9:89026808-89026830 CCTGCACACCTGGGCCCTTGGAC 0: 1
1: 0
2: 2
3: 45
4: 559
Right 1056715753 9:89026834-89026856 TCCTCTCTTTCATGCTCCTGTGG No data
1056715749_1056715757 27 Left 1056715749 9:89026808-89026830 CCTGCACACCTGGGCCCTTGGAC 0: 1
1: 0
2: 2
3: 45
4: 559
Right 1056715757 9:89026858-89026880 TTTCTGGACTAGCCTTGTCCAGG No data
1056715749_1056715758 28 Left 1056715749 9:89026808-89026830 CCTGCACACCTGGGCCCTTGGAC 0: 1
1: 0
2: 2
3: 45
4: 559
Right 1056715758 9:89026859-89026881 TTCTGGACTAGCCTTGTCCAGGG No data
1056715749_1056715755 11 Left 1056715749 9:89026808-89026830 CCTGCACACCTGGGCCCTTGGAC 0: 1
1: 0
2: 2
3: 45
4: 559
Right 1056715755 9:89026842-89026864 TTCATGCTCCTGTGGTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056715749 Original CRISPR GTCCAAGGGCCCAGGTGTGC AGG (reversed) Intronic
900746713 1:4365782-4365804 GCCCCAGGGCCCAGGTGTTACGG + Intergenic
901138600 1:7013498-7013520 GACAAAGGGGCCAGGTGTGGTGG - Intronic
901316890 1:8315669-8315691 GCCCACGGGGCCAGGTGTGCAGG - Intergenic
901423041 1:9163641-9163663 GTCCAAGGGGCCTGATGTGCAGG + Intergenic
902032557 1:13433844-13433866 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
902404459 1:16175180-16175202 CTCCATGGGCCCTGGGGTGCCGG + Intergenic
902651549 1:17840937-17840959 GTCCCTGGGCCCAGGTCAGCTGG + Intergenic
903108694 1:21108926-21108948 CTACAAGGGGCCAGGTGTGGTGG + Intronic
904325373 1:29724447-29724469 GTCCAAGGGCCCAGCCAGGCAGG - Intergenic
904405925 1:30287863-30287885 GTCCAAGGTCACAGGGGTGTAGG + Intergenic
906135889 1:43500757-43500779 GTCTCTGGGCCCAGCTGTGCAGG - Intergenic
906155905 1:43613779-43613801 GTCCTAGGTCCCAGCTGTGGTGG + Intronic
906979914 1:50619042-50619064 GAGCAAGGGGCCAGGTGTGCTGG - Intronic
907102173 1:51847375-51847397 GCCCAAGGGCTGAGGAGTGCGGG - Intronic
907759446 1:57343447-57343469 ACCCAAGGGCTCAGGAGTGCGGG - Intronic
909318482 1:74253334-74253356 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
909642175 1:77881611-77881633 GTCCCAGGGGCCAGGTGCGGTGG + Intergenic
909782220 1:79561526-79561548 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
910334401 1:86110911-86110933 GCCCAAGGGCTGAGGAGTGCCGG + Intronic
910550361 1:88467434-88467456 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
911001507 1:93170592-93170614 GCCCAAGGGCTGAGGAGTGCAGG + Intronic
912824732 1:112894979-112895001 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
913987157 1:143575418-143575440 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
915557371 1:156668174-156668196 CTCCCAGGGCCCAGGAGAGCAGG - Intergenic
918154637 1:181832774-181832796 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
918790034 1:188813386-188813408 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
918952058 1:191151745-191151767 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
919049729 1:192499099-192499121 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
919070682 1:192751454-192751476 GCCCAAGAGCTGAGGTGTGCAGG + Intergenic
919377218 1:196809172-196809194 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
919386932 1:196934073-196934095 GCCCAAGGGCTGAGGAGTGCAGG + Intronic
920878392 1:209858646-209858668 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
921096322 1:211889773-211889795 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
923157171 1:231289472-231289494 ACCCAAGGGCCAAGGAGTGCGGG - Intergenic
924306000 1:242689779-242689801 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
924313711 1:242774366-242774388 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1063148884 10:3319811-3319833 GCCCAAGGGCTAAGGAGTGCGGG - Intergenic
1063848770 10:10161256-10161278 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1066293683 10:34035750-34035772 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1066590503 10:36989298-36989320 GCCCAAGGGCTGAGGGGTGCTGG - Intergenic
1066613550 10:37275323-37275345 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
1066615002 10:37285165-37285187 GTCCAAGGGCTAAAGAGTGCGGG - Intronic
1067089503 10:43259415-43259437 ATCCAAGGGCCGAGCAGTGCAGG + Intronic
1067202994 10:44190454-44190476 GTACATGTGCACAGGTGTGCAGG - Intergenic
1068211392 10:53924542-53924564 GCCCAAGGGCTGAGGAGTGCGGG + Intronic
1068303296 10:55174519-55174541 GTCCAAGGTCGCATATGTGCAGG + Intronic
1068792336 10:61040977-61040999 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1069090748 10:64196769-64196791 GCCCAAGGGCTGAGGAGTGCCGG - Intergenic
1069631513 10:69899912-69899934 GCCCAAGGGCCTAGATGTTCAGG + Intronic
1069642830 10:69967110-69967132 CTCCAAGGGCACAGGGGGGCAGG - Intergenic
1070776201 10:79111280-79111302 GTCATGGGGCCCAGGTGGGCAGG + Intronic
1070942502 10:80359494-80359516 GCCCAAGGGCTGAGGAGTGCGGG - Intronic
1071332246 10:84571560-84571582 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1071569633 10:86689885-86689907 GGCCAAGGGCCAAGGACTGCAGG + Intronic
1071610944 10:87030983-87031005 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1071797022 10:89018651-89018673 ATCCAAGGGCTGAGGAGTGCGGG - Intergenic
1072004865 10:91235423-91235445 GTATAAAGGGCCAGGTGTGCTGG + Intronic
1072230440 10:93409790-93409812 GTCCAAAGGCTCAGGTTTCCAGG + Intronic
1072520685 10:96227378-96227400 GGCCGAGTGCCCAGGTCTGCGGG + Intronic
1073729159 10:106269851-106269873 GTCCAAGGCCCCATATGTACAGG + Intergenic
1074547198 10:114410120-114410142 GCCCAAGGCCACAGGTGGGCAGG + Intergenic
1075394767 10:122119380-122119402 GTCCAGGGGCTTAGGTGGGCAGG - Intronic
1075504939 10:123013499-123013521 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
1075568574 10:123521870-123521892 GTGCAAGGGCCCAGGTTGCCAGG + Intergenic
1075716324 10:124557866-124557888 GTCCACGGGCTCATGTGTTCAGG - Intronic
1075979093 10:126721841-126721863 GAACAAGGTCCCTGGTGTGCTGG + Intergenic
1076896030 10:133312645-133312667 GCCCCAGGGCCCAGGAGGGCCGG + Intronic
1077222404 11:1423612-1423634 GTCCAAGGTCCAGGGTGGGCTGG + Intronic
1077248059 11:1548664-1548686 GTCGGAGGCCCCAGGTGTGTGGG + Intergenic
1077308296 11:1877483-1877505 CTCCAGGGGCCCAGCTCTGCAGG + Intronic
1077326872 11:1967750-1967772 GCCCAGGGGCCCAGGCGAGCAGG - Intronic
1077369725 11:2175851-2175873 GTCCCAGGGCACAGACGTGCTGG - Intergenic
1077751691 11:4977940-4977962 GTCCAGGTGTCCAGGTGTCCAGG + Intronic
1080386057 11:31811799-31811821 TTCCAAGGGGCCAGGTGGGCTGG - Intronic
1080601988 11:33829367-33829389 GTCCGCGGGTCCAGGTGTGGGGG - Intergenic
1081939090 11:46925488-46925510 GTCCATAGGGCCAGGTGTGGTGG + Intergenic
1082278516 11:50246465-50246487 GTCAAAGGGGTGAGGTGTGCAGG - Intergenic
1083074233 11:60020254-60020276 ATCCAAGGGCTGAGGAGTGCGGG - Intergenic
1083162253 11:60861871-60861893 GGCCAAGTGGCCAGGTGTGGAGG + Intergenic
1083474854 11:62909201-62909223 TGCCTAGGGCCCAGGTGGGCGGG + Exonic
1084358403 11:68654043-68654065 GACCAAGGGCACAGCTGTGGAGG + Intergenic
1084476030 11:69390349-69390371 TTCCCAGGGCCCAGGGCTGCAGG - Intergenic
1084658683 11:70534576-70534598 GGACAAGGCCCCAGGTGTCCTGG + Intronic
1084689952 11:70719375-70719397 GTCCATGTCCCCAGGAGTGCTGG - Intronic
1085457339 11:76672494-76672516 GTCCAAGGGGCCAAATGTTCAGG + Intergenic
1086210058 11:84308547-84308569 GCCCAAGGGCTGAGGAGTGCGGG - Intronic
1087407252 11:97745612-97745634 GCCCAAGGGCTGAGGAGTGCCGG - Intergenic
1087621969 11:100553297-100553319 GGCAAAGGGCCCAGGTGGCCTGG + Intergenic
1089122321 11:116146091-116146113 GTCTAAGGCCCCATATGTGCAGG + Intergenic
1089666928 11:120026263-120026285 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1090275168 11:125413880-125413902 GCCCAGGAGCCCAGGTGTCCAGG + Intronic
1090558080 11:127898566-127898588 ACCCAAGGGCTGAGGTGTGCAGG - Intergenic
1090669561 11:128936954-128936976 GGTGCAGGGCCCAGGTGTGCTGG - Intronic
1090820465 11:130337393-130337415 GCCCAAGGGCTGAGGAGTGCCGG - Intergenic
1202809853 11_KI270721v1_random:22930-22952 GCCCAGGGGCCCAGGCGAGCAGG - Intergenic
1091896541 12:4109775-4109797 TTACAAGGGCCAAGGTGTACAGG - Intergenic
1092359752 12:7826340-7826362 GTACAAGGAGCCAGGTGTGGTGG - Intronic
1093524729 12:20093318-20093340 GTCCAAGGGCTGAGGAGTGCGGG - Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1094000213 12:25686616-25686638 GCCCAAGGGCTAAGGAGTGCAGG + Intergenic
1094496911 12:30994399-30994421 TTCCTAGGGCCCTGGTGTGCAGG - Exonic
1095514332 12:42989670-42989692 GTCAAGGGGCCCAGGGGTGTTGG - Intergenic
1095587477 12:43864262-43864284 GCCCAAGGGCTGAGGAGTGCAGG + Intronic
1095921234 12:47533129-47533151 GTCCTGGGGCCCAGTGGTGCTGG - Intergenic
1097253748 12:57656127-57656149 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1097413809 12:59289191-59289213 GTCACAGGGCCTTGGTGTGCAGG + Intergenic
1097863977 12:64543617-64543639 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1098498693 12:71166197-71166219 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
1099190151 12:79554026-79554048 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1099192493 12:79574235-79574257 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1099413649 12:82361412-82361434 GCCCAAGGGCTGAGGAGTGCGGG - Intronic
1099478722 12:83140428-83140450 GCCCAAGGGCTGAGGAGTGCCGG + Intergenic
1100142410 12:91634314-91634336 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1101725327 12:107383962-107383984 CTCCAAGCGCCCAGGTGTGCAGG + Intronic
1101883885 12:108644887-108644909 ATCCAAAGGCTCAGGTCTGCTGG + Intergenic
1102309826 12:111836016-111836038 ACCCAAGGGCTGAGGTGTGCGGG + Intergenic
1103238871 12:119397711-119397733 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
1103532347 12:121611358-121611380 GTCCAAGGGCAAAGAAGTGCAGG - Intergenic
1103760810 12:123249318-123249340 GCCCAAGGGCTGAGGAGTGCGGG - Intronic
1103911306 12:124354126-124354148 GTCCGAGGGCACCCGTGTGCTGG + Exonic
1103947580 12:124535164-124535186 GTCGATGGGCCCAGGTGTTCGGG - Intronic
1104388305 12:128370183-128370205 GTCTTAGGGCTCAGGTGTGCAGG + Intronic
1105777575 13:23677826-23677848 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1105889432 13:24671759-24671781 TTCCAAGGGCCCATGTGAGCCGG - Intergenic
1106040378 13:26084573-26084595 GGCCAAGGCCACAGATGTGCGGG + Intergenic
1106620443 13:31366566-31366588 GTCCAAGGTCCCCCATGTGCAGG + Intergenic
1108362250 13:49678330-49678352 GCCCAAGGGCTGAGGAGTGCCGG - Intronic
1108669748 13:52673397-52673419 GTAAAAGGGGCCAGGTGTGTTGG - Intronic
1109037672 13:57286610-57286632 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1109110953 13:58318532-58318554 GCCCAAGGGCTGAGGAGTGCTGG - Intergenic
1109406329 13:61904736-61904758 GTCAGAGGGCACAGTTGTGCTGG + Intergenic
1109506210 13:63306095-63306117 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1109884443 13:68524306-68524328 GTCCAAGGGCTGAGGAGTGCGGG + Intergenic
1112787573 13:102968147-102968169 GACAAAGGCTCCAGGTGTGCTGG + Intergenic
1113371888 13:109732666-109732688 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1113807160 13:113116612-113116634 CTCCCAGGGCCCAGGGGTGGTGG - Intronic
1113922368 13:113920265-113920287 GTGCCAGGCCCCATGTGTGCTGG + Intergenic
1113986599 13:114321516-114321538 GACTAAGAGCTCAGGTGTGCTGG - Intronic
1114155615 14:20099561-20099583 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1114528149 14:23379011-23379033 GTCCTGGGGGCCAGGGGTGCAGG - Exonic
1115174526 14:30547505-30547527 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1115284324 14:31700913-31700935 GCCCAAGGGCTGAGGAGTGCAGG + Intronic
1115421291 14:33198736-33198758 ACCCAAGGGCTCAGGAGTGCAGG - Intronic
1115643803 14:35352788-35352810 GACCGAGGGCCCAGATGTGCAGG + Intergenic
1116152055 14:41154243-41154265 GTCCAAGGGCTGAGGAGTGCAGG - Intergenic
1116223128 14:42113489-42113511 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1116297847 14:43135924-43135946 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1116311071 14:43326966-43326988 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1116657046 14:47665924-47665946 GCCCAAGGGCTGAGGAGTGCGGG + Intronic
1117082650 14:52167106-52167128 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1117360033 14:54963822-54963844 ATCAAGGGGGCCAGGTGTGCTGG + Intronic
1117748527 14:58896876-58896898 CTCCCAGGGCCCAGGTGAGCAGG + Intergenic
1120214607 14:81668711-81668733 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1120632246 14:86905421-86905443 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1120996530 14:90422214-90422236 GTCCCAGTGGCCAGGTGTGGTGG - Intergenic
1121145458 14:91578337-91578359 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1122216464 14:100208163-100208185 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1122514598 14:102298052-102298074 GCCCAAGGGCTGAGGGGTGCAGG + Intronic
1122894763 14:104751521-104751543 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1122930306 14:104930155-104930177 GGCCAAGTCCCCAGGAGTGCAGG - Intronic
1123051954 14:105548208-105548230 GTCCAAGGGCTGAGGAGTGTGGG + Intergenic
1123108242 14:105852853-105852875 TCCCAAGGGCCCATCTGTGCAGG - Intergenic
1123139481 14:106061462-106061484 ATCCCAGGGCTCAGGTCTGCAGG - Intergenic
1123144515 14:106115953-106115975 ATCCCAGGGCTCAGGTCTGCAGG - Intergenic
1124562043 15:30783190-30783212 GCCCAAGGGCCAAGGAGTGCAGG - Intergenic
1124661104 15:31551753-31551775 ATCCGAGGGCCCAGGTGGGGAGG - Intronic
1124857800 15:33407515-33407537 TTCCAAGGCCCCAGGTGATCTGG - Intronic
1125558707 15:40609118-40609140 GTACTAGGGGCCGGGTGTGCTGG + Intronic
1125609762 15:40961981-40962003 ATCCAAGGGCTGAGGAGTGCGGG + Intergenic
1125986716 15:44060349-44060371 GTTCAAGGGCCCAGGGGAGAAGG + Intronic
1126165467 15:45651009-45651031 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
1128140991 15:65301063-65301085 GCCCAAGGGCTGAGGAGTGCCGG - Intergenic
1128594047 15:68928951-68928973 GCCCAAGGGCTGAGGAGTGCGGG - Intronic
1129158205 15:73732182-73732204 GCCCAAGGGCTAAGGAGTGCGGG - Intergenic
1130295759 15:82646564-82646586 GTGCAAGGGGCCAGGGCTGCAGG + Intronic
1131176527 15:90212724-90212746 GTCTAAGGGCCCAGGTGCTTGGG - Intronic
1132294527 15:100725736-100725758 GGCCAAGGCCACAGGTGGGCTGG + Intergenic
1132697816 16:1209787-1209809 GTCCACGGGGCCAGGTGAGCGGG - Intronic
1133814219 16:9184197-9184219 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1136356700 16:29748689-29748711 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1136870052 16:33798648-33798670 ATCCCAGGGCTCAGGTCTGCAGG + Intergenic
1137563094 16:49515635-49515657 GACCTAGGGCCCAGGGGTGAAGG + Intronic
1137945749 16:52731771-52731793 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1138109440 16:54311969-54311991 ATCCCAGGGACCAGGAGTGCAGG + Intergenic
1138688847 16:58749220-58749242 GCCCAAGGGCTGAGGGGTGCCGG + Intergenic
1138889809 16:61128752-61128774 GCCCAAGGGCTGAGGAGTGCCGG - Intergenic
1139358529 16:66382068-66382090 GTCCACGGACCAAGGTCTGCTGG - Intronic
1139600346 16:67982586-67982608 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1140469887 16:75208018-75208040 GCTCCAGGGCCCAGGTGTGCTGG - Intergenic
1141326138 16:83061166-83061188 GACCTAGGGCCCAGGTTTCCAGG + Intronic
1142031881 16:87842618-87842640 GTCCCAGATGCCAGGTGTGCTGG + Intronic
1142066703 16:88067106-88067128 ATCCTAGGGCCCAGGTGTGTGGG + Intronic
1142225766 16:88876991-88877013 GTCCAGTGGGCCAGGTGGGCTGG + Exonic
1142411789 16:89920755-89920777 GGCCAAGGGACCAGGTTTGCAGG + Exonic
1203102118 16_KI270728v1_random:1317406-1317428 ATCCCAGGGCTCAGGTCTGCAGG - Intergenic
1142593788 17:1019832-1019854 TTCCATGGGCCCAGGGGAGCAGG + Intronic
1142658535 17:1411149-1411171 GTCCAGAGGGCCGGGTGTGCTGG - Intergenic
1143037104 17:4005580-4005602 TTGCAAGGGCCCAAGTCTGCAGG - Exonic
1143743591 17:8973103-8973125 GCCTAAGGGGCCAGGTGTGGTGG + Intergenic
1144131078 17:12248534-12248556 GTCCACGGGGCCAGGTGCGGTGG + Intergenic
1144636446 17:16912264-16912286 GTCAAAGCGGCCAGGTGTGGTGG - Intergenic
1144714807 17:17426599-17426621 GTCCATGGTCCCATATGTGCAGG + Intergenic
1144804614 17:17956493-17956515 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
1145050233 17:19654309-19654331 GCCCAAGGGCTGAGGGGTGCAGG - Intronic
1146789883 17:35745262-35745284 GTCCAAGGGCGAAGGTGTGGGGG + Exonic
1146842048 17:36163047-36163069 GGCCACGGGTCCAGGTGAGCCGG - Intergenic
1147186880 17:38717755-38717777 GTGCAGGGGGCCGGGTGTGCTGG - Intronic
1147200594 17:38799190-38799212 GGGCAAGGGCCCAGGGCTGCAGG + Intronic
1147228416 17:38999194-38999216 GTCCTAAGGGCCAGGTGTGGTGG - Intergenic
1147689294 17:42305727-42305749 GTCCTAGGGCCTGGGGGTGCTGG - Intronic
1148105974 17:45119083-45119105 GTCAAAGGGGCCAGGTTTCCTGG - Intronic
1148206939 17:45784918-45784940 GTCCCGGGGCCGAGGTCTGCAGG - Intronic
1148758242 17:49985803-49985825 TTCCGAGGCCCCAGGTGGGCAGG - Intergenic
1148991305 17:51669111-51669133 GCCCAAGGGCTGAGGAGTGCAGG + Intronic
1149916456 17:60613980-60614002 GCCCAAGGGCTGAGGAGTGCGGG + Intronic
1150216923 17:63476454-63476476 GCCCCAAGCCCCAGGTGTGCCGG + Intergenic
1150388827 17:64779641-64779663 GTCCAAGGGCCTTGGTGTGGGGG + Intergenic
1150790625 17:68198283-68198305 GTCCAAGGGCCTCGGTGTGAGGG - Intergenic
1151438442 17:74113306-74113328 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1151460383 17:74250550-74250572 GTACAAGGGACCAGGGGTTCGGG + Intronic
1151567402 17:74907040-74907062 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1151840580 17:76614914-76614936 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1153070446 18:1098595-1098617 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1153428385 18:4990091-4990113 GTCCAAGGTCCCATATGTGCAGG - Intergenic
1153875811 18:9369551-9369573 GGCAAAGGGCCCAGGTGCGGTGG - Intronic
1154231093 18:12557143-12557165 GCCCAAGGGCTGAGGAGTGCGGG - Intronic
1154231366 18:12559078-12559100 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
1154294054 18:13134682-13134704 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1154300462 18:13186841-13186863 GGCCAAGGGCCCAGAGCTGCTGG + Intergenic
1154346695 18:13548655-13548677 CTCCAAGAGTCCAGGGGTGCAGG + Intronic
1154351769 18:13589587-13589609 GTCCAAGGCCACAGGGCTGCAGG - Intronic
1154358821 18:13642407-13642429 TTCCAAGGCCCCACGCGTGCTGG - Intronic
1154942912 18:21132532-21132554 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1155611648 18:27673886-27673908 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1155785895 18:29899080-29899102 GCCCAAGGGCTGAGGAGTGCTGG - Intergenic
1156006206 18:32445025-32445047 ATCCATGGGCACAGGTGTTCTGG - Intronic
1156242974 18:35271649-35271671 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
1156683635 18:39618828-39618850 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1157556889 18:48618672-48618694 CTGCAGGGGCCCAGGTCTGCTGG - Intronic
1157661886 18:49452721-49452743 GCCCAAGGGCTGAGGAGTGCAGG + Intronic
1157856845 18:51111840-51111862 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1159744020 18:72209491-72209513 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1160525641 18:79533871-79533893 GTGCTGGGGCCCAGGGGTGCTGG - Intergenic
1160693405 19:470727-470749 CTCCAAGGTCCCAGCTGGGCTGG - Intronic
1161244735 19:3243567-3243589 GTCCACTGGGCCAGGTGTGGTGG - Intronic
1161556396 19:4945064-4945086 GTTCATGGGGCCAGGCGTGCAGG + Intronic
1161973491 19:7596411-7596433 GTCCAAGCCTCCAGGTGAGCCGG + Intronic
1162796145 19:13088619-13088641 GCCCAAGGGCCCAGGGATGGAGG - Intronic
1162873282 19:13601663-13601685 GGCCAAAGGACCAGGTGTGGTGG + Intronic
1163389467 19:17021656-17021678 GTCTAATGGTTCAGGTGTGCTGG + Intronic
1164667114 19:30047914-30047936 GCCCTAGGGTCCAGCTGTGCTGG + Intergenic
1167171015 19:47832024-47832046 GTTCTAGGGGCCAGGTGTGGTGG - Intronic
1167566499 19:50260911-50260933 GTGCAGGGGCCCAGGTGGTCGGG + Intronic
1167784704 19:51627568-51627590 GGCCCAGGGCCCAGCTGAGCTGG + Exonic
1168250598 19:55139489-55139511 GTCCATGGGCCCAGACATGCAGG - Intronic
925008811 2:467183-467205 CTCCCAGGGCCCAGGTGGGAGGG - Intergenic
927156971 2:20226051-20226073 GTCTCAGGGCCCAGGTGCGAAGG - Intergenic
927518892 2:23687629-23687651 GTCCAAGGGCCTGGCTGTGGGGG + Intronic
927777854 2:25915825-25915847 ATCCAAGGGCTGAGGAGTGCAGG + Intergenic
928091052 2:28375375-28375397 CTCCAAGGGCCCTGGTGGGCTGG - Intergenic
928617882 2:33057423-33057445 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
928723056 2:34142531-34142553 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
928751392 2:34474663-34474685 GTCCAAGGTCCCTGTTGTGAGGG - Intergenic
928939164 2:36709751-36709773 GACCAAAAGCCCAGGTGTGCTGG + Intronic
929221344 2:39467793-39467815 CTCTGAGGGCCCAGGTGAGCTGG + Intergenic
932178340 2:69622404-69622426 GCCCAAGGGCTGAGGAGTGCAGG + Intronic
933049980 2:77590836-77590858 GCCCAAGGGCTGAGGAGTGCAGG + Intronic
933060780 2:77734776-77734798 GCCCAAGGGCTGAGGAGTGCTGG - Intergenic
933415884 2:81985521-81985543 GTCCAAGGGCTGACGAGTGCGGG + Intergenic
933506372 2:83181363-83181385 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
933733939 2:85480051-85480073 GTCAAAGGAGCCAGGTGTGGTGG + Intergenic
935731178 2:106065830-106065852 GTGCTGGGGCCCAGGTGAGCGGG + Exonic
935866500 2:107392649-107392671 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
935878303 2:107536087-107536109 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
937139674 2:119589026-119589048 GTCCAAGAGCCCTGGCTTGCAGG - Intronic
937246591 2:120497761-120497783 CTCCATGGGCCCAGGGCTGCTGG + Intergenic
937275319 2:120680307-120680329 GTCCAAGAGCCCAGGTGTGTTGG - Intergenic
939886381 2:147686260-147686282 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
939898979 2:147827223-147827245 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
941878539 2:170459626-170459648 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
942317532 2:174709566-174709588 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
942368597 2:175256997-175257019 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
942865281 2:180666069-180666091 TTCTAAGGGGCCAGGTGTGGTGG + Intergenic
943134502 2:183892899-183892921 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
943179992 2:184529346-184529368 GTCTAAGGTCCCATGTGTGCAGG - Intergenic
943443360 2:187952079-187952101 GCCCAAGGGCCGAGGAGTGCAGG + Intergenic
943520560 2:188944431-188944453 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
943961102 2:194264814-194264836 CCCCAAGGGCACAGGGGTGCTGG - Intergenic
944055233 2:195515991-195516013 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
944482852 2:200175102-200175124 GCCCAAGGGCTGAGGAGTGCCGG + Intergenic
944671272 2:201996233-201996255 GACCAAGGGCCCAGGTGGGTGGG - Intergenic
945069692 2:205977548-205977570 GCCCAAGGGCTGAGGAGTGCTGG + Intergenic
945302504 2:208227702-208227724 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
945451436 2:210000613-210000635 GCCCAAGGGCTGAGGAGTGCCGG - Intergenic
945744283 2:213701590-213701612 TTCCAAGGGCTGAGGAGTGCAGG + Intronic
945762275 2:213928377-213928399 ATCCAAGGGGCCAGGTGTGATGG - Intronic
946054057 2:216885587-216885609 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
946929212 2:224655667-224655689 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
947668810 2:231924147-231924169 GGCCATGGGCCAGGGTGTGCTGG + Intronic
947906430 2:233766558-233766580 GTCCATGGGCACAGGTCTGGGGG + Intronic
947937963 2:234024274-234024296 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1169101600 20:2954508-2954530 GGCAAAGGGGCCAGGTGTGGTGG - Intronic
1170930961 20:20768828-20768850 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1171395420 20:24829814-24829836 GGCCAGGAGCCCAGGCGTGCAGG + Intergenic
1171488433 20:25500169-25500191 GTGCAGGGGCAGAGGTGTGCAGG - Intronic
1172202421 20:33135886-33135908 GTGCAATGGACCAGGTGTGGTGG - Intergenic
1172842888 20:37912643-37912665 CTCCAAGGGCACCAGTGTGCAGG - Intronic
1173778830 20:45736255-45736277 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1173831574 20:46092226-46092248 GCCCAAGGGCTGAGGAGTGCCGG + Intergenic
1174110648 20:48195619-48195641 GTCCAAGAACCCTGGGGTGCAGG - Intergenic
1174766069 20:53255229-53255251 GTGTAAGGGGCCAGGTGTGTGGG - Exonic
1175100330 20:56574772-56574794 GTTCCAGGGCCCAAGGGTGCAGG + Intergenic
1175111868 20:56654137-56654159 TTGCAAGGGGCCAGGTGTGGTGG - Intergenic
1175641743 20:60635992-60636014 GGCCATGAGCCAAGGTGTGCAGG - Intergenic
1175961445 20:62638801-62638823 GGCCAAGGGCCCAGCTCAGCAGG + Intergenic
1176025292 20:62982468-62982490 GCCCAAGGGGCCAGGAGTGCAGG + Intergenic
1176096118 20:63345373-63345395 TTCCAAGGGCCCAGAGGGGCGGG - Exonic
1176189437 20:63800896-63800918 GCCCAAGGGCTGAGGAGTGCAGG + Intronic
1176872190 21:14092966-14092988 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1177318775 21:19493906-19493928 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1177565770 21:22818855-22818877 ATCCAAGGGCTGAGGAGTGCGGG - Intergenic
1179464285 21:41561468-41561490 ATCCAATGGTGCAGGTGTGCTGG - Intergenic
1179507106 21:41848632-41848654 GGACAAGGGCCCAGGTTAGCTGG + Intronic
1179909888 21:44442097-44442119 GGCCAAGGGCCCAGCTGCACAGG - Exonic
1180007013 21:45027536-45027558 GACTCAGGGCCCATGTGTGCAGG - Intergenic
1180218407 21:46341652-46341674 GTCCAGGAGGCCAGGTGTGGAGG - Intronic
1180785194 22:18543295-18543317 GTGGGAGGGCTCAGGTGTGCTGG - Intergenic
1181242097 22:21482648-21482670 GTGGGAGGGCTCAGGTGTGCTGG - Intergenic
1181477612 22:23178581-23178603 GTCCAAGGGACCAGGATGGCAGG + Intergenic
1182479444 22:30597228-30597250 GCCCAAGGGCTGAGGAGTGCGGG + Intronic
1182757218 22:32689887-32689909 GCCCAAGAGGCCAGGTGTGGTGG + Intronic
1183388317 22:37527924-37527946 GTCTTTGGGGCCAGGTGTGCGGG - Intergenic
1184288861 22:43487559-43487581 GTCCTAGGAGCCAGGGGTGCAGG + Intronic
1184906185 22:47488303-47488325 GCCCAAGGGCTGAGGAGTGCCGG - Intergenic
1185012452 22:48322125-48322147 GTCCCAGGGTCCAGGTGTCTGGG + Intergenic
1185012567 22:48322525-48322547 GTCCTAGGGCCCAGGTGTCTGGG + Intergenic
1185229054 22:49670198-49670220 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
949281549 3:2352749-2352771 GCCCAAGGGCTGAGGAGTGCAGG + Intronic
949981948 3:9507705-9507727 GGCCAAGGGCCCACCTGGGCGGG - Intronic
950139783 3:10607514-10607536 GGCCAGGGTGCCAGGTGTGCAGG - Intronic
950203661 3:11061736-11061758 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
950601292 3:14037569-14037591 GCCCAAGGGCTGAGGAGTGCAGG + Intronic
952011221 3:28903163-28903185 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
952453756 3:33453820-33453842 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
952598183 3:35044352-35044374 ATCTCAGGACCCAGGTGTGCTGG - Intergenic
953423081 3:42770030-42770052 GCCCAAGGGCTGAGGAGTGCGGG + Intronic
953537276 3:43786123-43786145 GTGAAAGTGCCCAGGTGTGTGGG + Intergenic
954089267 3:48271937-48271959 GCCCAAGGGCTGAGGTGTGCAGG - Intronic
954215373 3:49121517-49121539 GCGCAAGGCCCAAGGTGTGCTGG - Exonic
954773798 3:52998630-52998652 GTCCATTGGCCCAGGTGGGTGGG - Intronic
955054524 3:55443937-55443959 GTGCAAAGGCCCAGGGGTGAGGG - Intergenic
956127394 3:66023882-66023904 GTCCCAGGGCCCTGGTCTGCCGG - Intronic
956183875 3:66544641-66544663 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
956273838 3:67476613-67476635 GTCCAAGGGTGCAGGGTTGCGGG - Intronic
956632660 3:71331461-71331483 GCCCAAGGGCTGAGGAGTGCGGG + Intronic
957386504 3:79502585-79502607 GCCCAAGGGCTGAGGAGTGCAGG + Intronic
957919617 3:86731507-86731529 GTCCAAGGGCTGAGGAGTGCGGG - Intergenic
959462518 3:106644137-106644159 ATCCAAGGGCTGAGGAGTGCAGG + Intergenic
960479598 3:118171734-118171756 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
960487372 3:118270028-118270050 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
960669267 3:120140612-120140634 GCCCAAGGGCTGAGGAGTGCTGG + Intergenic
960685550 3:120290033-120290055 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
961139688 3:124545548-124545570 GTCCTAGAGCCCAGGGGTGAGGG + Intronic
961700728 3:128742923-128742945 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
961932260 3:130547061-130547083 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
962177178 3:133167396-133167418 GCCCAAGGGCTGAGGAGTGCGGG - Intronic
962296490 3:134193468-134193490 GTCAAAGGGGCCGGGTGTGGTGG - Intronic
962383702 3:134916352-134916374 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
962591008 3:136889997-136890019 ACCCAAGGGCTCAGGAGTGCGGG - Intronic
962671619 3:137714478-137714500 GCCCAAGGGCTAAGGAGTGCGGG - Intergenic
964265318 3:154889244-154889266 ACCCAAGGGCCGAGGAGTGCAGG - Intergenic
964376412 3:156052334-156052356 ACCCAAGGGCTGAGGTGTGCAGG + Intronic
964474599 3:157087390-157087412 TTCTAAGAGCCCAGCTGTGCTGG + Intergenic
964982444 3:162702916-162702938 GCCCAAGGGCCGAGGAGTGCGGG - Intergenic
965003583 3:162987684-162987706 ATCCAAGGGCCGAGGAGTGCAGG + Intergenic
965429490 3:168568741-168568763 GGCCAGGGGGCCAGGTGTGGTGG - Intergenic
965587039 3:170327788-170327810 GCCCAAGGGCTGAGGGGTGCGGG + Intergenic
965652426 3:170947587-170947609 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
965726891 3:171727193-171727215 GTCCACGGGCCCTAGTTTGCAGG + Intronic
966186110 3:177228655-177228677 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
966246012 3:177808939-177808961 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
966425412 3:179775515-179775537 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
966761313 3:183421569-183421591 TTCAAAGGGGCCAGGTGTGGTGG - Intronic
966916445 3:184586897-184586919 GTCCTAGGGCCCATGAGAGCAGG + Intronic
968490490 4:888385-888407 GTCCAAGGGCGCGTCTGTGCGGG - Intronic
968904095 4:3443735-3443757 GTCCCAGGACCCATGTGAGCAGG - Intronic
969016320 4:4106615-4106637 GCTCAGGGGCCCAGGTGTGCAGG + Intergenic
969548065 4:7845132-7845154 GTCCAGGAGGCCAGGTGTGGTGG + Intronic
969663254 4:8542743-8542765 CACTCAGGGCCCAGGTGTGCAGG - Intergenic
970408581 4:15786730-15786752 GTCCAAGGGCTGAGGAGTGCGGG - Intronic
970574517 4:17414301-17414323 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
970576806 4:17436559-17436581 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
971043289 4:22778604-22778626 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
972360882 4:38324912-38324934 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
972505726 4:39718510-39718532 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
972913374 4:43846542-43846564 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
974911857 4:68132589-68132611 GTCCTAGAGCCCAGTGGTGCTGG + Intergenic
975160774 4:71121307-71121329 GCCCAAGGGCTGAGGCGTGCAGG + Intergenic
975754913 4:77562306-77562328 GCCCAAGGGCTGAGGAGTGCGGG + Intronic
976106992 4:81629892-81629914 ATCCTAGGGGCCAGGTGTGGTGG + Intronic
976406443 4:84665055-84665077 ATCCAAGGGCTGAGGAGTGCAGG + Intergenic
976479224 4:85520258-85520280 ATCCAAGTGCCCAGGTGTGGAGG + Intronic
977507756 4:97923385-97923407 GCCCAAGGGCTAAGGAGTGCAGG + Intronic
977885222 4:102245402-102245424 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
978425408 4:108577013-108577035 GTCAAAGGGGCCAGGTGCGGTGG + Intergenic
978466318 4:109012836-109012858 GCCCAAGGGCTGAGGAGTGCAGG + Intronic
978809155 4:112831170-112831192 GCCCAAGGGCTGAGGAGTGCGGG + Intronic
979188973 4:117833893-117833915 GTCCGAGGCCCCAAATGTGCAGG - Intergenic
979609079 4:122670576-122670598 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
979865277 4:125745352-125745374 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
980716431 4:136636141-136636163 GTCCAAGGGCACAGGCCTGGGGG - Intergenic
980739320 4:136929359-136929381 GCCCAAGGGCTGAGGGGTGCAGG + Intergenic
980774560 4:137421385-137421407 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
982768998 4:159378456-159378478 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
983656802 4:170091595-170091617 GCCCAAGGGCTGAGGAGTGCGGG + Intronic
983734774 4:171043522-171043544 GCCCAAGGGCTGAGGAGTGCCGG + Intergenic
983843119 4:172481882-172481904 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
984069350 4:175092478-175092500 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
984805286 4:183746445-183746467 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
985324768 4:188754857-188754879 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
985412045 4:189695685-189695707 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
985593577 5:777823-777845 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
985773341 5:1826636-1826658 GTCCTTGGGGCCAGGTTTGCTGG - Intergenic
985988626 5:3537671-3537693 ATCCAGGGGCCCAGCTGTTCTGG + Intergenic
986343674 5:6814666-6814688 GTCCCCAGGCACAGGTGTGCTGG + Intergenic
986357502 5:6943125-6943147 ATCCAAGGGCTCAGCTGTGCTGG - Intergenic
986661818 5:10065868-10065890 GTCCAAGGGCTGAGGAGTGCGGG + Intergenic
986744161 5:10729906-10729928 GTCCCAGGACACAGCTGTGCAGG - Intronic
986963652 5:13244550-13244572 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
987084417 5:14455890-14455912 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
987488759 5:18551692-18551714 GCCCAAGGGCTAAGGAGTGCAGG - Intergenic
988143008 5:27267247-27267269 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
988500211 5:31777480-31777502 ATCCAAGGGCTGAGGGGTGCAGG + Intronic
989950632 5:50293212-50293234 GCCCAAGGGCTGAGGAGTGCTGG + Intergenic
990880284 5:60530662-60530684 GCCCAAAGGCTGAGGTGTGCGGG + Intergenic
991006504 5:61833051-61833073 GGCCAAGGAGCCAGGTGTCCCGG + Intergenic
991330176 5:65485474-65485496 ACCCAAGGGCCGAGGAGTGCGGG - Intergenic
992050425 5:72935608-72935630 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
992802927 5:80309986-80310008 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
993803478 5:92374889-92374911 GCCCAAGGGCTGAGGGGTGCGGG - Intergenic
994620411 5:102155305-102155327 GCCCAAGGGCTGAGGAGTGCCGG + Intergenic
994768555 5:103953773-103953795 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
995041261 5:107590678-107590700 GTCCATGAGGCCAGGTGTGGTGG - Intronic
995206597 5:109487845-109487867 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
995224906 5:109690580-109690602 CTCCGAGGGGCCAGGCGTGCGGG + Intronic
995582688 5:113617674-113617696 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
995678961 5:114695787-114695809 GCCCAAGGGCTAAGGAGTGCAGG + Intergenic
995679807 5:114704284-114704306 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
997262534 5:132475680-132475702 GTCCAAAGGCCCGGCTGTGCAGG - Intronic
997296658 5:132772908-132772930 GTACAGGGGCCCATGTCTGCTGG - Intronic
997375567 5:133394715-133394737 GCCCAAGGGCTGAGGAGTGCGGG + Intronic
997644570 5:135472900-135472922 GGCTAAGGGGCCAGGTGTGGTGG + Intergenic
997693516 5:135843899-135843921 GACCCAGGGCCTGGGTGTGCAGG - Intronic
997760625 5:136444579-136444601 ACCCAAGGGCCGAGGAGTGCGGG + Intergenic
1000204784 5:159048441-159048463 GTCCCAGGGTGCTGGTGTGCAGG - Intronic
1000903499 5:166936256-166936278 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1001636508 5:173213796-173213818 GCCCAAGGGCTGAGGAGTGCCGG + Intergenic
1002681569 5:180969479-180969501 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1003836151 6:10074705-10074727 GCCCAAGGGCTGAGGAGTGCGGG - Intronic
1004452327 6:15758753-15758775 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1004647970 6:17580984-17581006 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1004905481 6:20233538-20233560 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1005685301 6:28248058-28248080 CTCCAGGGTCCCAGGTGAGCTGG - Exonic
1005751242 6:28885130-28885152 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1006434064 6:34017170-34017192 GCCCAAGGGCTGAGGAGTGCTGG - Intergenic
1006513551 6:34534085-34534107 GCCCAGGAGGCCAGGTGTGCAGG - Exonic
1006642367 6:35496031-35496053 GCCCCAGGGCCCAGCTGGGCTGG + Intronic
1007356342 6:41320508-41320530 GTCCAAGGGAGCAGGTGGACAGG + Intergenic
1007727910 6:43927817-43927839 CTCCAAGGTACCAGGTGAGCTGG - Intergenic
1007763832 6:44149766-44149788 GGCCAAGGGCCCAGCTGGGGAGG + Intronic
1007982283 6:46171234-46171256 TTCCAGGGGACCAGCTGTGCTGG + Intergenic
1008572465 6:52829179-52829201 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1008631056 6:53363445-53363467 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1010269409 6:73903518-73903540 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1011129266 6:84037474-84037496 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
1012733497 6:102910718-102910740 GCCCAAGGGCTGAGGAGTGCTGG - Intergenic
1012760438 6:103294399-103294421 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1014088314 6:117373286-117373308 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
1018551280 6:165001625-165001647 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1018631769 6:165827551-165827573 TTCCAAGTGCACCGGTGTGCTGG + Intronic
1018699153 6:166413052-166413074 CTCCTGGGGCCCACGTGTGCTGG - Intronic
1018902561 6:168058801-168058823 GTTGCAGGGCCCAGGTGTCCGGG + Intronic
1019437645 7:1030303-1030325 GTCCCCGGGCTCAGGTGTGGAGG - Intronic
1019502090 7:1369513-1369535 GGCCAAGGTCCTAGGTGGGCTGG - Intergenic
1020163976 7:5793858-5793880 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1021513738 7:21461193-21461215 GCCCAAGGGCTGAGGAGTGCGGG - Intronic
1022207464 7:28179373-28179395 GTCCAGGGGTCCAGGCGTGAAGG + Intronic
1023378048 7:39577763-39577785 GCCCAAGGGCTGAGGAGTGCGGG + Intronic
1024748140 7:52431237-52431259 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1026098278 7:67364533-67364555 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1026124070 7:67563985-67564007 ATCCTAGAGGCCAGGTGTGCTGG - Intergenic
1026639313 7:72110279-72110301 GTCCAAAGGCTCAGCTGTCCGGG - Intronic
1028058666 7:86282147-86282169 GCCCAAAGGCCGAGGAGTGCAGG - Intergenic
1028557979 7:92143366-92143388 ATCCAAGGGCTGAGGAGTGCGGG - Intronic
1028989571 7:97034711-97034733 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1029037958 7:97541491-97541513 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1029183217 7:98719818-98719840 GTCCAGGGACCCTGGAGTGCAGG + Intergenic
1029407165 7:100382097-100382119 GCCCAAGGGCCGAGGAGTGCGGG + Intronic
1030292712 7:107888185-107888207 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1030772158 7:113488130-113488152 GCCCAAGGGCTAAGGTGTGCAGG - Intergenic
1031014576 7:116559122-116559144 GTACAACTGCCCAGATGTGCAGG - Exonic
1031902931 7:127429529-127429551 GCCCAAGGGCTGAGGAGTGCGGG + Intronic
1031913842 7:127544335-127544357 GGCCAAAGGCCCAGGGGTGAGGG - Intergenic
1032197004 7:129795207-129795229 GTCCAGGGGCCCAGGCCTGGTGG - Intergenic
1032437183 7:131909690-131909712 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1032507877 7:132449726-132449748 GTACAAAAGCCCAGGTTTGCTGG + Intronic
1033839847 7:145360591-145360613 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1035115381 7:156519092-156519114 GTCCAGGCGTCCAGGTGTCCAGG - Intergenic
1035248388 7:157580643-157580665 GTTCAGGGGCTCGGGTGTGCAGG - Intronic
1035248422 7:157580771-157580793 GTGCAGGGGCTCGGGTGTGCAGG - Intronic
1035248439 7:157580835-157580857 GTGCAGGGGCTCGGGTGTGCAGG - Intronic
1035248462 7:157580915-157580937 GTGCAGGGGCTCGGGTGTGCAGG - Intronic
1035248485 7:157580995-157581017 GTGCAGGGGCTCGGGTGTGCAGG - Intronic
1035248506 7:157581070-157581092 GTGCAGGGGCTCGGGTGTGCAGG - Intronic
1035248514 7:157581102-157581124 GTCCAGGTGCTCGGGTGTGCAGG - Intronic
1035248521 7:157581150-157581172 GTGCAGGGGCTCAGGTGTGCAGG - Intronic
1035376720 7:158411425-158411447 GTGCAAGGGCCCAGGGGACCAGG - Intronic
1035476985 7:159150775-159150797 ACCCAGAGGCCCAGGTGTGCCGG + Intergenic
1035683507 8:1507153-1507175 CTCCAAGGGCTGAGGAGTGCAGG - Intronic
1036123766 8:6045056-6045078 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1037065091 8:14567201-14567223 GCCCAAGGGCTGAGGAGTGCAGG + Intronic
1037924881 8:22836413-22836435 GTCCAGAGACCTAGGTGTGCAGG - Intronic
1039479342 8:37860251-37860273 GTCCAAGTGCCCTGGGGGGCAGG - Exonic
1040003631 8:42600052-42600074 GCCCAAGGGCTAAGGAGTGCAGG - Intergenic
1040459053 8:47629463-47629485 GTACAAAGGGCCAGGTGTGGTGG + Intronic
1040804399 8:51377885-51377907 GCCCAAGGGCTGAGGAGTGCAGG + Intronic
1040806776 8:51404819-51404841 GCCCAAGGGCTGAGGAGTGCCGG - Intronic
1040952941 8:52954174-52954196 GCCCAAGGGCTGAGGTGTGCAGG + Intergenic
1040964523 8:53071139-53071161 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1041018557 8:53615630-53615652 GTCCAAGGGGTCAGGTGAGATGG + Intergenic
1041068597 8:54104560-54104582 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1041623610 8:60000226-60000248 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1042169429 8:65977792-65977814 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1043857218 8:85276390-85276412 ACCCAAGGGCCGAGGAGTGCGGG + Intronic
1044862095 8:96533842-96533864 GCCCAAGGGCTGAGGAGTGCGGG - Intronic
1045096286 8:98800951-98800973 GCCCAAGGGCTGAGGAGTGCAGG + Intronic
1045407315 8:101879977-101879999 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
1046521333 8:115330562-115330584 ACCCAAGGGCTGAGGTGTGCAGG - Intergenic
1047124822 8:121948444-121948466 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1048112914 8:131487393-131487415 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1048265705 8:132983882-132983904 GTCCAGGAGCCCAGGTGCCCAGG + Intronic
1048410194 8:134164380-134164402 GTAAAAGGGGCCAGGTGTGGTGG - Intergenic
1048996224 8:139795180-139795202 GCCCGGGGGCCCAGGTGTCCTGG + Intronic
1049157751 8:141077005-141077027 GCCCAAGGGCTGAGGAGTGCCGG + Intergenic
1049355835 8:142187582-142187604 GTGCTAGGGCCCAGGTGCCCCGG - Intergenic
1049944450 9:580767-580789 ACCCAAGGGCTCAGGAGTGCGGG - Intronic
1050718283 9:8555127-8555149 CTCAAAGGGGCCAGGTGTGGTGG + Intronic
1051449342 9:17178408-17178430 GCCCAAGGGCTGAGGAGTGCGGG - Intronic
1051459285 9:17294678-17294700 ATCCAAGGGCTGAGGAGTGCTGG - Intronic
1053055685 9:34991886-34991908 GCCCAAGGCCCTAGGTGGGCAGG - Intronic
1053076776 9:35140480-35140502 GTCCAAGGTCCCTTATGTGCAGG + Intergenic
1053551434 9:39083371-39083393 GTTTAAGGGGCCAGGTGTGGTGG + Intronic
1055654996 9:78442438-78442460 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1056216342 9:84408845-84408867 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1056677193 9:88685920-88685942 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1056715749 9:89026808-89026830 GTCCAAGGGCCCAGGTGTGCAGG - Intronic
1056825528 9:89874019-89874041 GGCCCAGGGCACAGGTGAGCTGG - Intergenic
1057118228 9:92545610-92545632 GCCCAAGGGCTGAGGAGTGCGGG + Intronic
1057244816 9:93446024-93446046 CTCCCAGGTCCCAGGTGTGGTGG - Intergenic
1057407743 9:94788920-94788942 GGCAAATAGCCCAGGTGTGCAGG + Intronic
1058379511 9:104362898-104362920 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1058585322 9:106501335-106501357 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1058723490 9:107780097-107780119 GTCCAGGGTGCCAGATGTGCTGG - Intergenic
1058727591 9:107818166-107818188 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1059891394 9:118809255-118809277 GCCCAAGGGCTGAGGAGTGCCGG - Intergenic
1060193747 9:121609604-121609626 GGCCAAGGCCCCTGGTGGGCAGG + Intronic
1060210691 9:121708458-121708480 GACCCAGGGCACTGGTGTGCAGG - Intronic
1060803742 9:126562118-126562140 GAGAAAGGGCCCAGGTGTGTGGG + Intergenic
1061929396 9:133824683-133824705 GTCCCAGGTCCCAGGTCTGTGGG + Intronic
1061947968 9:133919453-133919475 TTCCAGGAGCCCAGGTGTCCCGG + Intronic
1062098118 9:134712966-134712988 GTCCAGGGCTCCAGGAGTGCTGG - Intronic
1062150460 9:135015808-135015830 GACCAAGGGTCCAGATGTCCAGG + Intergenic
1062233692 9:135497952-135497974 GCCCAGTGTCCCAGGTGTGCAGG + Intronic
1062286922 9:135777536-135777558 GTCTGAGGGCCCGGGTGGGCGGG - Intronic
1062611376 9:137375784-137375806 GACCTAGGGCCCACGTGTCCCGG - Intronic
1062678463 9:137762679-137762701 GGCCAACGGTCCAGATGTGCTGG + Exonic
1203670549 Un_KI270755v1:7296-7318 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1185757263 X:2661709-2661731 GTCCAATGGCCCATGAGTGTGGG + Intergenic
1187703838 X:21990027-21990049 GTTTAAGGGGCCAGGTGTGGCGG - Intronic
1189186198 X:39057500-39057522 CGGAAAGGGCCCAGGTGTGCAGG + Intergenic
1189414753 X:40803974-40803996 GTCTAAGGTCCCATCTGTGCAGG - Intergenic
1190190353 X:48271868-48271890 GTCCTAGAGGCCAGGTGTGGTGG + Intronic
1191053853 X:56222600-56222622 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1192034233 X:67545881-67545903 GTCCATGGGCCTGGGTGTGGAGG + Exonic
1192156426 X:68750200-68750222 GTCCATGGGTACAGGTGTCCAGG + Intergenic
1194197631 X:90914940-90914962 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1194379516 X:93176482-93176504 GTCCAAGGTCCCTTATGTGCAGG + Intergenic
1194384444 X:93236101-93236123 GCCCAAGGGCTGAGGAGTGCGGG + Intergenic
1194890430 X:99372068-99372090 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1195460215 X:105115746-105115768 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
1197704801 X:129626955-129626977 TTCAAAGGGACCAGGTATGCAGG + Intergenic
1198241905 X:134796099-134796121 ATCCATGGGCTCAGGTGAGCAGG - Exonic
1199094778 X:143726231-143726253 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1199832881 X:151562658-151562680 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1200079093 X:153566719-153566741 GTGCAGGGGTGCAGGTGTGCAGG - Intronic
1200544105 Y:4497873-4497895 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1200896128 Y:8377918-8377940 GTCCAATGGCCCAAGTAAGCGGG + Intergenic
1200955376 Y:8938692-8938714 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1201260902 Y:12158439-12158461 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1201499515 Y:14627294-14627316 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
1201901051 Y:19046561-19046583 GCCCAAGGGCTGAGGAGTGCGGG - Intergenic
1201934037 Y:19386643-19386665 GCCCAAGGACCCAGGGGTGTGGG + Intergenic
1202202371 Y:22367143-22367165 GCCCAAGGGCTGAGGAGTGCAGG - Intronic
1202271433 Y:23078336-23078358 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1202294593 Y:23342346-23342368 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic
1202424428 Y:24712080-24712102 GCCCAAGGGCTGAGGAGTGCAGG - Intergenic
1202446361 Y:24958005-24958027 GCCCAAGGGCTGAGGAGTGCAGG + Intergenic