ID: 1056717375

View in Genome Browser
Species Human (GRCh38)
Location 9:89043224-89043246
Sequence TCATTCTCACACCTACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056717375_1056717378 6 Left 1056717375 9:89043224-89043246 CCAGGCTGTAGGTGTGAGAATGA 0: 1
1: 0
2: 0
3: 11
4: 181
Right 1056717378 9:89043253-89043275 GTGCTAACATTCCCTCGCTGGGG No data
1056717375_1056717376 4 Left 1056717375 9:89043224-89043246 CCAGGCTGTAGGTGTGAGAATGA 0: 1
1: 0
2: 0
3: 11
4: 181
Right 1056717376 9:89043251-89043273 TCGTGCTAACATTCCCTCGCTGG No data
1056717375_1056717381 28 Left 1056717375 9:89043224-89043246 CCAGGCTGTAGGTGTGAGAATGA 0: 1
1: 0
2: 0
3: 11
4: 181
Right 1056717381 9:89043275-89043297 GAGCACCACCTGCAACATCATGG No data
1056717375_1056717377 5 Left 1056717375 9:89043224-89043246 CCAGGCTGTAGGTGTGAGAATGA 0: 1
1: 0
2: 0
3: 11
4: 181
Right 1056717377 9:89043252-89043274 CGTGCTAACATTCCCTCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056717375 Original CRISPR TCATTCTCACACCTACAGCC TGG (reversed) Intronic
901506567 1:9689404-9689426 AAATTCTCACACCCCCAGCCGGG - Intronic
903674750 1:25056602-25056624 TCAGTCTCACACCCGCTGCCTGG - Intergenic
904343356 1:29852422-29852444 TCTCTCTCACACCCACAGGCAGG - Intergenic
904641317 1:31932660-31932682 TCATTCTCTCACCTAAGTCCTGG + Intronic
905358762 1:37403835-37403857 ACTTTCTCAAAGCTACAGCCAGG + Intergenic
906979111 1:50609177-50609199 TTATTCACAAACCTAAAGCCTGG - Intronic
907748905 1:57243527-57243549 TTATGCTCAAACCCACAGCCCGG + Intronic
910201035 1:84698962-84698984 TCTTCCTCCCACCTCCAGCCAGG + Intergenic
915653424 1:157336774-157336796 ACACCCTCACACCTCCAGCCTGG - Intergenic
917435281 1:175014978-175015000 ACAATCTAACACCCACAGCCTGG - Intronic
918079004 1:181191453-181191475 TAATCCTCACACGAACAGCCTGG - Intergenic
919939864 1:202278753-202278775 GCCTGCTCACACCTCCAGCCAGG - Intronic
922061405 1:222096183-222096205 TCATGCCCACACATACACCCAGG + Intergenic
922442636 1:225668989-225669011 TCTTTCTCTCACCGTCAGCCTGG + Intergenic
923680413 1:236114053-236114075 TCACTTTCACAGCTACAGCGGGG + Intergenic
1062910612 10:1209425-1209447 CCATGCCCACACCTACAGCCTGG + Intronic
1062910674 10:1209695-1209717 CCATGCCCACACCTACAGCTTGG + Intronic
1062938261 10:1403685-1403707 TCATTCTCAGAGCTGCAGCCTGG + Intronic
1067210011 10:44252280-44252302 ATTTTCTCACACCTACAGCAGGG - Intergenic
1067257936 10:44662243-44662265 TCATTCTTACTCCTTCAGCCTGG + Intergenic
1069558453 10:69413251-69413273 ACATTCTCACACTTAAAACCAGG + Intronic
1070522218 10:77264068-77264090 AAATTCCCACTCCTACAGCCTGG + Intronic
1070585986 10:77766543-77766565 TCATTCGCACGGCTACAACCTGG - Intergenic
1071249614 10:83803597-83803619 TGATTCACACACCTCCCGCCAGG + Intergenic
1072850828 10:98889878-98889900 TCATACTCTCATTTACAGCCTGG + Intronic
1073227628 10:101936938-101936960 TAATTCTCACAACTACTACCTGG + Intronic
1075115015 10:119618947-119618969 TCATTTTCAAGCTTACAGCCTGG + Intergenic
1075594710 10:123720612-123720634 TCATTCTGATACCAACAGCAAGG + Intronic
1078794721 11:14580874-14580896 TCATTCTCCCATCTTCAGCATGG + Intronic
1079817539 11:25080727-25080749 TCAGTCTCCCACCTCCACCCTGG + Exonic
1080262387 11:30363836-30363858 GAATTCTCACACTTACAACCAGG + Intergenic
1081445809 11:43130608-43130630 GCATTCTCAGCCCTAAAGCCAGG - Intergenic
1081623805 11:44634843-44634865 TCATTCTCACAGGGGCAGCCAGG - Intergenic
1083194294 11:61073984-61074006 TCATTATCAGGCCTAAAGCCAGG - Intergenic
1085002705 11:73055069-73055091 TCATTCTCTTGCCTACCGCCAGG - Intronic
1085331028 11:75651249-75651271 TCATTCTCACAAATGCAGTCTGG + Intronic
1087139369 11:94750440-94750462 GCATTCTCATCCCTGCAGCCAGG - Intronic
1089503474 11:118947108-118947130 TCATTCCCATACCTACTGCCTGG + Intronic
1091105487 11:132915352-132915374 TCATTCTCACACCAGCTGCAAGG + Intronic
1091395434 12:151563-151585 TCATTTTCTCTCCAACAGCCAGG + Intronic
1091752309 12:3030697-3030719 TCAGTCTCCCACCTTTAGCCAGG + Intronic
1092583194 12:9870510-9870532 TCATCCTCACCCCTGAAGCCAGG + Intergenic
1093775015 12:23063705-23063727 TCAATTTTACACCTAGAGCCTGG + Intergenic
1100365782 12:93919156-93919178 TCATTCTCACAAGAACAGCATGG + Intergenic
1102595027 12:113985723-113985745 TAATTCTCACACCCACACCTAGG - Intergenic
1103179902 12:118901518-118901540 ACATTCACACACCCACCGCCTGG - Intergenic
1104682766 12:130762613-130762635 TCCTTCTCACACCTCCACCTTGG - Intergenic
1107001191 13:35547416-35547438 CCATTCTCTTAGCTACAGCCTGG - Intronic
1107023805 13:35778931-35778953 TCATTCTCACATCTACCTCTTGG + Intronic
1107363308 13:39642853-39642875 GCATTCTCTTACCTACATCCTGG - Intergenic
1109896246 13:68695518-68695540 TCTTTATCACACCTTCATCCTGG + Intergenic
1112652804 13:101416726-101416748 TCAGTCTCACAGCAACAGCTAGG + Intergenic
1112662297 13:101524017-101524039 TCTTTCACCCACTTACAGCCAGG - Intronic
1112713113 13:102152948-102152970 TCATTCTCCCTCCTACACCGTGG + Intronic
1114131960 14:19801436-19801458 ACTTCCTCACATCTACAGCCTGG - Intronic
1114463136 14:22901081-22901103 TCACTCTCACACCTCCTGGCAGG + Exonic
1116754497 14:48929190-48929212 ACATTCTCACAGATACACCCGGG - Intergenic
1117498332 14:56327809-56327831 TCATTCCCACACTTGGAGCCAGG + Intergenic
1119368561 14:74117574-74117596 TCATTCTTAAACCCAAAGCCTGG - Intronic
1120300448 14:82699658-82699680 CAATTCTCACCCCTACTGCCAGG - Intergenic
1121795197 14:96728660-96728682 TCATTCTCACCCCAAGAGCTGGG - Intergenic
1122508957 14:102250436-102250458 TCATCCTCACACCTGTGGCCAGG + Intronic
1122774004 14:104109215-104109237 TCATTCTCACACAGGCATCCGGG + Exonic
1123575040 15:21657159-21657181 ACTTCCTCACATCTACAGCCTGG - Intergenic
1123611656 15:22099648-22099670 ACTTCCTCACATCTACAGCCTGG - Intergenic
1123885840 15:24727600-24727622 TCCTTGCCACACCCACAGCCTGG + Intergenic
1127517571 15:59710897-59710919 TCCTTATCACACCCCCAGCCCGG - Intergenic
1127687011 15:61356057-61356079 TCATTCCCAAACTCACAGCCAGG - Intergenic
1127860528 15:62989986-62990008 GCCCTCTCACCCCTACAGCCTGG + Intergenic
1130876832 15:88021912-88021934 TCCTTCTCCCACCTACAAGCAGG - Intronic
1202983908 15_KI270727v1_random:391403-391425 ACTTCCTCACATCTACAGCCTGG - Intergenic
1133679467 16:8107530-8107552 TCTTTCTCACTCCTACAAGCCGG - Intergenic
1134131173 16:11651219-11651241 TCATCCCCACAGCTACAGCTGGG + Intergenic
1134336464 16:13304205-13304227 TCATTCACACAAATCCAGCCTGG - Intergenic
1134600609 16:15530790-15530812 TCATTCTCTCTCCTGCCGCCTGG + Intronic
1136226685 16:28864580-28864602 TCCTGTTCAAACCTACAGCCAGG - Intronic
1136872361 16:33819287-33819309 TCATTATCACACGAACAGCCTGG + Intergenic
1138038879 16:53640115-53640137 TTTTTCTCACCCCTACACCCAGG - Intronic
1141573791 16:84951269-84951291 TCATTCTCCTACCTGTAGCCGGG - Intergenic
1203099811 16_KI270728v1_random:1296781-1296803 TCATTATCACACGAACAGCCTGG - Intergenic
1149364853 17:55933214-55933236 TCATTCTCATCCCCACAGCAGGG + Intergenic
1152615798 17:81337226-81337248 CCATTCTCACACCCACACCCGGG - Intergenic
1159002787 18:62988347-62988369 TCATTCCCACGGCTGCAGCCAGG + Intergenic
1161401626 19:4068125-4068147 TCATTCTAACACCTAATCCCAGG + Intergenic
1164283450 19:23789516-23789538 TGATTCTCACACCTTGAACCAGG + Intronic
1164294941 19:23901614-23901636 TGATTCTCACACCTTGAACCAGG + Intergenic
1164687462 19:30177112-30177134 CCATTCTCACTCCTAGAGCTAGG + Intergenic
1166920671 19:46227025-46227047 TCATTCTCTCACCCACTTCCTGG - Intergenic
926244969 2:11116369-11116391 TCATTCTTGCAGCTACAGCATGG - Intergenic
932055713 2:68441375-68441397 ATATACTCACACCTACAGCTTGG + Intergenic
933097254 2:78202311-78202333 TCAAACTGACACCTACAGCTAGG + Intergenic
933483148 2:82882558-82882580 TATTTCTCACACACACAGCCTGG - Intergenic
934854589 2:97721309-97721331 TCATTCTCAGACATACAGAGTGG + Intronic
935896499 2:107743573-107743595 TCTTTCTCTTGCCTACAGCCAGG + Intergenic
936572279 2:113627077-113627099 TCAGTACCACACCCACAGCCAGG + Intergenic
937469800 2:122165356-122165378 ACATTCTCAAACCTCCAGCCAGG - Intergenic
937871992 2:126792588-126792610 CCATGCTCACACCTAGAGCAAGG - Intergenic
938258192 2:129876936-129876958 TCCCTTTCCCACCTACAGCCTGG + Intergenic
939727390 2:145739618-145739640 TCATTCTCACACTTTCTGCTAGG + Intergenic
939763157 2:146210120-146210142 TCATTCTCACTCTAACTGCCAGG - Intergenic
939781689 2:146458049-146458071 TCATTCTCACAAGAACAGCACGG + Intergenic
945305431 2:208254992-208255014 TCAGACTCACAACCACAGCCTGG + Intronic
946009867 2:216555669-216555691 TCATTCTTGCATCTGCAGCCTGG - Intronic
948017911 2:234705134-234705156 TCATTTTCCCATCTACAACCAGG + Intergenic
948932581 2:241141630-241141652 TCACACTCGCACCTCCAGCCTGG + Intronic
1170039902 20:12028882-12028904 TCACTGTCATACCTACAGACAGG - Intergenic
1171163651 20:22951738-22951760 TCATTGTCCGACCTACTGCCTGG + Intergenic
1173155886 20:40608313-40608335 CCAAACTCACACCTCCAGCCAGG - Intergenic
1173381240 20:42544677-42544699 GCATTCTCACATAAACAGCCAGG - Intronic
1173821167 20:46021685-46021707 TCTTTCTCCCTCCTAGAGCCTGG + Intergenic
1174599485 20:51712864-51712886 GCATTCCCACACCTGCGGCCCGG + Intronic
1175069964 20:56324884-56324906 TAATTTTCACACACACAGCCAGG - Intergenic
1177310339 21:19384108-19384130 TCTCTCTCCCACCTACTGCCAGG + Intergenic
1179589250 21:42395203-42395225 CCATTCTGACACCCACAGGCTGG - Intronic
949366392 3:3286160-3286182 TGTTTCACACACCCACAGCCTGG + Intergenic
949830895 3:8212989-8213011 TCATTATCACAACAACAGCATGG - Intergenic
949891648 3:8737770-8737792 ACATTCCCACCCCTGCAGCCTGG - Intronic
950654030 3:14425602-14425624 TTATTCTCCCATGTACAGCCTGG - Intronic
951563081 3:23987445-23987467 TCACTCTCACAAGAACAGCCAGG - Intergenic
959525851 3:107375689-107375711 TCATTGTCACACTTACAGAGTGG - Intergenic
961773570 3:129267926-129267948 TCCATCACACACCTGCAGCCAGG - Exonic
964062374 3:152539193-152539215 TTATTCTCATGCCTCCAGCCTGG - Intergenic
969333605 4:6494182-6494204 TCCGTCTCAGCCCTACAGCCAGG + Intronic
973807180 4:54537857-54537879 TCACTGTCACACCCACACCCTGG - Intergenic
976427887 4:84927634-84927656 TCATTATCACAACAACAGCATGG - Intronic
979092371 4:116501405-116501427 TCATTCTCATATCTTCAGCCAGG + Intergenic
980218471 4:129881987-129882009 TGATTCTCAGGCCAACAGCCAGG + Intergenic
981455824 4:144952244-144952266 GCATGCTCACACCCACACCCTGG + Intergenic
981725176 4:147839979-147840001 TGATTCTCAAAACTACAGCATGG + Intronic
981857121 4:149307924-149307946 TCATTCTCAGGCCTTCAGACTGG + Intergenic
984378004 4:178956392-178956414 TCATTTTCACAAGAACAGCCTGG - Intergenic
985775470 5:1839271-1839293 TCAGTCTCTCCCCTAAAGCCTGG + Intergenic
987846941 5:23299365-23299387 TCATTGTAACACCTACCTCCTGG + Intergenic
988434354 5:31156192-31156214 CCATACTCTCATCTACAGCCTGG - Intergenic
989263242 5:39442739-39442761 TCATTTTCACACCTTCAGAAAGG - Intronic
989318078 5:40104933-40104955 TCTTTCTCACACCCTCATCCTGG + Intergenic
990001782 5:50901841-50901863 TCATTCTCACAAGAACAGCACGG - Intergenic
991122673 5:63033556-63033578 TCATTATCACAAGAACAGCCTGG - Intergenic
991556014 5:67895864-67895886 TCATTCTCTCTCCTGCTGCCAGG - Intergenic
992508202 5:77408263-77408285 TCATGCTCACACCAAAAACCTGG - Intronic
993380750 5:87204447-87204469 TCATGGTCACACCTCCAGCAAGG - Intergenic
994351450 5:98750951-98750973 TCATTATCACAACAACAGCATGG + Intergenic
995141139 5:108736952-108736974 TCTCTCTCTCACCTACTGCCAGG - Intergenic
998199200 5:140106284-140106306 TCATTTTCTCACCTCCAGCTAGG + Intergenic
999748963 5:154611941-154611963 TCATTCTCACATCTTCTCCCAGG - Intergenic
1000120155 5:158189648-158189670 TCAGACTCACACCTACAACATGG - Intergenic
1002724615 5:181286374-181286396 TCTGTCTCAAACCCACAGCCAGG + Intergenic
1005143388 6:22660161-22660183 TCATTCCCACAAATACATCCAGG + Intergenic
1007139247 6:39554868-39554890 TCATGGTTACACCTACAACCTGG + Intronic
1011309624 6:85967639-85967661 TCATACTCCTACCAACAGCCAGG - Intergenic
1012369323 6:98483563-98483585 TCATTCCCACACTCATAGCCAGG + Intergenic
1013648237 6:112167205-112167227 TCACTATTACACCTACAGCATGG - Intronic
1013887015 6:114980225-114980247 TCCTGCTCACACATACATCCAGG - Intergenic
1014307287 6:119758248-119758270 TAATTCTGACACCTACTGCTGGG + Intergenic
1015844312 6:137503632-137503654 TCATTCTCTCTCCTGCCGCCCGG - Intergenic
1016840057 6:148516907-148516929 TCATTCTCACCCTTGCACCCTGG + Intronic
1019628422 7:2033196-2033218 CCATTCTCACAGAGACAGCCCGG + Intronic
1022037338 7:26547046-26547068 CTATCCTCACACCTGCAGCCGGG + Intergenic
1024171952 7:46798015-46798037 TCACTATCACAACAACAGCCAGG + Intergenic
1024710345 7:52008589-52008611 TCATTGTCACACAGACAGCCTGG + Intergenic
1025787494 7:64657101-64657123 TAATGCTCACGCCTACAACCAGG + Intergenic
1026598313 7:71752647-71752669 TCCTTTCCACACCAACAGCCTGG - Intergenic
1028857558 7:95608849-95608871 TCAGTCCCACACCCACAGCCTGG + Intergenic
1032066673 7:128776418-128776440 TCCTACTCAGACCTCCAGCCAGG + Intergenic
1032933248 7:136698283-136698305 TCTTTTTAACACTTACAGCCTGG + Intergenic
1033859443 7:145606892-145606914 TCTATTTCACCCCTACAGCCTGG - Intergenic
1034321161 7:150183872-150183894 TCATTATCACAAGAACAGCCTGG - Intergenic
1034771588 7:153783392-153783414 TCATTATCACAAGAACAGCCTGG + Intergenic
1036750716 8:11442227-11442249 TCATGCTCACATCTCCTGCCAGG - Intronic
1037985870 8:23290209-23290231 TCATTCTCACACCTTTGTCCTGG - Exonic
1038717541 8:30005333-30005355 TCACTCTCACAAGAACAGCCTGG + Intergenic
1043383055 8:79723304-79723326 GCAATCTCCCACCTGCAGCCTGG - Intergenic
1045293082 8:100850519-100850541 CCATTCTCAGACCTCCTGCCGGG + Intergenic
1048471078 8:134704497-134704519 CCCTTCTCATCCCTACAGCCTGG + Intronic
1049711009 8:144063323-144063345 TACTTCTCACACCTCCACCCCGG + Intronic
1053034026 9:34809674-34809696 TCATTCTCACCCTTACGGGCAGG + Intergenic
1056334856 9:85558141-85558163 TCCTTTTCATACCTACAGCATGG - Intronic
1056717375 9:89043224-89043246 TCATTCTCACACCTACAGCCTGG - Intronic
1059517121 9:114906323-114906345 TCATTCTCACTACCACTGCCTGG - Intronic
1061516461 9:131093105-131093127 TCATATGCACACCCACAGCCAGG - Intronic
1062290762 9:135793406-135793428 TCAGCCTCACCCCTGCAGCCAGG + Intergenic
1185596605 X:1310837-1310859 TCATTCAAACACCTCCTGCCAGG - Intergenic
1185742769 X:2547095-2547117 TCATTATCACACAAACAGCAAGG - Intergenic
1188141112 X:26553074-26553096 TCACTCTCACAAGAACAGCCCGG + Intergenic
1189607915 X:42699582-42699604 TCATTCTCATATCTGCAGCTTGG - Intergenic
1192198088 X:69045790-69045812 TCATTGTCACACCTGGAGTCTGG - Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1192860051 X:75058051-75058073 CCTTTCTCACCCCCACAGCCTGG - Intronic
1197115243 X:122824546-122824568 GCTTTCTCACACTTTCAGCCTGG + Intergenic
1198104290 X:133447777-133447799 ACTTTCTCACACCTGCAGCTTGG - Intergenic
1198364320 X:135925374-135925396 TCTTTCCCTGACCTACAGCCAGG + Intergenic
1198780878 X:140234167-140234189 TCATTATCACAAGAACAGCCTGG - Intergenic
1202079810 Y:21072607-21072629 TGACTCTCAGACCTACAACCTGG + Intergenic