ID: 1056717771

View in Genome Browser
Species Human (GRCh38)
Location 9:89046884-89046906
Sequence GTATCAAGAAAGCCCCCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056717764_1056717771 18 Left 1056717764 9:89046843-89046865 CCTGGGCTGTGTCAGGAGCATGG 0: 1
1: 0
2: 2
3: 31
4: 448
Right 1056717771 9:89046884-89046906 GTATCAAGAAAGCCCCCTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056717771 Original CRISPR GTATCAAGAAAGCCCCCTGG AGG Exonic
903356071 1:22748355-22748377 GGACCCAGAAAGCCCCCTTGAGG - Intronic
903448690 1:23438171-23438193 GAATCAGGAAAGGCTCCTGGAGG - Intronic
903708421 1:25303864-25303886 GCTTCAAGAAAGCAGCCTGGTGG + Intronic
903718693 1:25388549-25388571 GCTTCAAGAAAGCAGCCTGGTGG - Intronic
903821378 1:26105132-26105154 GTAGCAAGCCTGCCCCCTGGTGG - Intergenic
903825834 1:26145259-26145281 GTATCAGGAAAGCTTCTTGGAGG + Intergenic
903941598 1:26935555-26935577 CTATCAAGAAAGCAGCATGGGGG + Intronic
907314101 1:53557492-53557514 GTGTCCAGAAAGCCTCTTGGAGG + Intronic
907920265 1:58904996-58905018 GAATCAGGAAAGCTGCCTGGAGG - Intergenic
909707741 1:78607511-78607533 GTAGCAAGAGAACCCCCTTGTGG + Intergenic
910192016 1:84604459-84604481 GGATCACGAAATCCCCCTGTCGG - Intergenic
913539450 1:119804894-119804916 GCATCAAGAAAGCACCTTGCAGG - Intronic
917499940 1:175577008-175577030 TTTTCAAGCATGCCCCCTGGGGG + Intronic
919046934 1:192464180-192464202 GTAGCAGGAAGGTCCCCTGGGGG - Intergenic
1066681191 10:37938065-37938087 GTTTCTAGAACGCCTCCTGGAGG + Intergenic
1067726555 10:48775096-48775118 ACAGCAGGAAAGCCCCCTGGAGG - Intronic
1069407874 10:68121819-68121841 CTCTAAAGAAAGCCCCCAGGAGG + Exonic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1080979541 11:37384871-37384893 GTATCTAGAAAGCTTCTTGGTGG - Intergenic
1081994066 11:47352465-47352487 GAATCAAAAAAGGACCCTGGAGG + Intronic
1083587477 11:63870752-63870774 GGATCAGGAAAGCTTCCTGGTGG + Intronic
1083614779 11:64021015-64021037 GTATCAAGATAAGCACCTGGGGG - Intronic
1083726471 11:64631061-64631083 GTACCAAGCAGGCCCCCAGGGGG + Intronic
1084615695 11:70234402-70234424 GTATTAAGCATGCCCCATGGGGG + Intergenic
1085442636 11:76578228-76578250 GTTTCAGGACAGCCCCGTGGGGG - Intergenic
1086121745 11:83311920-83311942 GAAACAAGAAATCCCCCTGCTGG + Intergenic
1087765203 11:102144075-102144097 GGAGCCAGAAAGCACCCTGGAGG - Intronic
1091894410 12:4089485-4089507 CTAGCAACAAAGCCTCCTGGCGG + Intergenic
1095098320 12:38159491-38159513 GCAGCAAGAAAGCCCCGGGGGGG + Intergenic
1098479976 12:70946282-70946304 GTTTCATAAAAGCCCTCTGGTGG + Intergenic
1101796366 12:107978298-107978320 GAATCTAGAGAGCCCCTTGGAGG + Intergenic
1103003625 12:117404961-117404983 ATATCAGCAAAGTCCCCTGGAGG + Intronic
1103851024 12:123933822-123933844 GTTACAAGAAAGCCACCTGATGG - Intronic
1104760505 12:131295232-131295254 GTCCCCAGAAATCCCCCTGGGGG + Intergenic
1104819270 12:131665553-131665575 GTCCCCAGAAATCCCCCTGGGGG - Intergenic
1105414148 13:20193976-20193998 GTATCCAGAAAGCCCCCAGCAGG - Intergenic
1107735526 13:43395000-43395022 GTAGCAAGAAGGCCCTCTGATGG + Intronic
1107735539 13:43395120-43395142 GTAGCAAGAAGGCCCTCTGATGG + Intronic
1109524539 13:63557921-63557943 GTATCAAGAGAGGGACCTGGTGG + Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1118275007 14:64378465-64378487 GAATCAAGAAAACTCCCTGGAGG - Intergenic
1123002973 14:105306244-105306266 GAATGAAGAAAGCCTCCAGGAGG - Exonic
1123175846 14:106417908-106417930 GTGTCCTGAATGCCCCCTGGTGG + Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202854754 14_GL000225v1_random:43407-43429 GCCTCACGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202864269 14_GL000225v1_random:104948-104970 GTCTCACAAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1123582700 15:21730866-21730888 GTGTCATGAGCGCCCCCTGGTGG + Intergenic
1123619350 15:22173462-22173484 GTGTCATGAGCGCCCCCTGGTGG + Intergenic
1124140812 15:27075764-27075786 GTATCAGGATGGCTCCCTGGTGG + Intronic
1135691988 16:24545638-24545660 ATTCCAAGAAAGCCCCTTGGAGG - Intronic
1136453404 16:30367539-30367561 GTATCAGGGAAGCTTCCTGGAGG + Intronic
1137522418 16:49205817-49205839 GTATCATAAAATCCCACTGGGGG + Intergenic
1141764207 16:86047948-86047970 GCAGCAAGAAAGCCTCATGGAGG + Intergenic
1146572190 17:33962302-33962324 GTATCAACAAAGCCCTCCTGGGG + Intronic
1146828437 17:36045505-36045527 GTTTAAAGAAATCCCTCTGGGGG - Intergenic
1147469477 17:40646448-40646470 GTATCAAGAAAGTTCCCTTGAGG - Intronic
1147563142 17:41521152-41521174 GTATAGAGAAAGCCACCTCGAGG - Exonic
1152882939 17:82830699-82830721 GTACCAAGGCAGCCCCCAGGCGG - Exonic
1156352156 18:36310881-36310903 GGGTGAAGATAGCCCCCTGGAGG + Intronic
1157535350 18:48453426-48453448 ATACCCAGAGAGCCCCCTGGGGG + Intergenic
1158851956 18:61503512-61503534 GGATCAATATGGCCCCCTGGGGG - Intronic
1161989397 19:7676165-7676187 GTCTCAAAAAAGAACCCTGGAGG - Intergenic
1165722193 19:38087528-38087550 GGATCAAGACAGACCGCTGGCGG + Intronic
1167607964 19:50491571-50491593 GAAACAGGAAAGCCCCATGGAGG + Intergenic
931152020 2:59585126-59585148 GGATCCAGAATGCCCCCTGGTGG + Intergenic
932276138 2:70453626-70453648 TTATCAAGAAAGCCGAGTGGAGG - Intronic
941512251 2:166426339-166426361 GTATCTGGCAAGCCCCCTAGCGG + Intronic
1168916427 20:1491921-1491943 TTATAAAGCAAGCCCCATGGGGG + Intergenic
1168919031 20:1515799-1515821 GTATGAAGACAGCACCCTTGAGG - Intergenic
1170351699 20:15448341-15448363 TTAACAAGCAAGGCCCCTGGAGG + Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171993821 20:31717181-31717203 GCTTCAAGAAAGCCCCATGATGG + Intronic
1173191664 20:40881537-40881559 GTATGAGGAAAGCCTCTTGGGGG - Intergenic
1175038291 20:56021049-56021071 GAATCAAGAAAACCACCTCGAGG - Intergenic
1175799685 20:61794327-61794349 TTATCAAGACACCCGCCTGGGGG + Intronic
1176377699 21:6094585-6094607 GTATCTGGACAGCTCCCTGGGGG + Intergenic
1176987001 21:15448825-15448847 GTGTCATGGAAGCCACCTGGTGG + Intergenic
1178631527 21:34265407-34265429 GAATCTAGATAGGCCCCTGGAGG + Intergenic
1178758224 21:35373610-35373632 GGAGCTAGAAAGTCCCCTGGAGG - Intronic
1179441952 21:41401100-41401122 GTGTCAAGAGAGCAACCTGGTGG - Intronic
1179745775 21:43443659-43443681 GTATCTGGACAGCTCCCTGGGGG - Intergenic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1180692673 22:17730326-17730348 GTATCAAGAATGCCTCGAGGGGG - Intronic
1181789485 22:25253253-25253275 GTATCAGAAAAGCCCCAGGGTGG + Intergenic
950905698 3:16536041-16536063 GTGCCAGGAAAGCCCCCTGCTGG + Intergenic
950917204 3:16658071-16658093 GTAGCAGGGAAGCCCCCTGGAGG - Intronic
952937603 3:38412481-38412503 GTATCAAAGAAGACCCTTGGTGG + Intronic
953707830 3:45244622-45244644 GCATCCAGAAAGCTTCCTGGAGG + Intergenic
954758438 3:52856209-52856231 GTAACAAGAGAACCTCCTGGAGG + Intronic
955549254 3:60065985-60066007 GTAACAAGAAGACCTCCTGGAGG - Intronic
960080591 3:113536099-113536121 CTATCTTGAAATCCCCCTGGTGG - Intronic
962673641 3:137735595-137735617 ATATCAAGGGAGCACCCTGGTGG - Intergenic
963125880 3:141815764-141815786 GTTTCAAGACAGCCCTGTGGAGG + Intronic
966222168 3:177561537-177561559 GGGTGAAGAAAGCCCCCTGTTGG + Intergenic
969437645 4:7198020-7198042 ATATCAAGAAACAGCCCTGGAGG + Intronic
971616489 4:28796848-28796870 GAAACAAGCAAGCCCACTGGGGG + Intergenic
978000123 4:103547259-103547281 AAATCCAGCAAGCCCCCTGGTGG - Intergenic
978137297 4:105277614-105277636 GAATCCAGTAAGCCCCATGGTGG - Exonic
985355856 4:189117622-189117644 ATATCAAGAGCGCACCCTGGGGG + Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
987706929 5:21469938-21469960 GTTCCAACAATGCCCCCTGGAGG - Intergenic
989631252 5:43484410-43484432 TTATCAAGAAATCCCCAAGGGGG - Intergenic
992149100 5:73884152-73884174 GTATTAAGAAAGCCCAGTGGTGG - Intronic
999276705 5:150336063-150336085 GAATCAAGAAGGGCCCCTGTGGG + Intronic
999793653 5:154967191-154967213 GTATCAAAACAGCCACCTGCAGG - Exonic
1001690612 5:173629902-173629924 GTATCAGGAGAGCTCCATGGTGG + Intergenic
1013035835 6:106381808-106381830 CTAGCCAGAAAGCCCCCAGGTGG + Intergenic
1013925791 6:115470067-115470089 GATTCAAGAAAGCTCCCTGGTGG + Intergenic
1019257432 7:61215-61237 GGAGCAGGAAAGCCCCATGGGGG - Intergenic
1024026234 7:45412315-45412337 GAGTCAGGAAGGCCCCCTGGAGG - Intergenic
1024547966 7:50538256-50538278 GGGTCCAGAAAGCCCACTGGTGG + Intronic
1024992892 7:55250394-55250416 GACTCAGGACAGCCCCCTGGAGG - Intronic
1026100231 7:67378375-67378397 GAATCAAGAGTGACCCCTGGTGG - Intergenic
1029926826 7:104328048-104328070 GTAACAAGAAAGACTCTTGGGGG + Intergenic
1030314682 7:108102770-108102792 GTATCATGGAAGCCTGCTGGGGG - Intronic
1032438927 7:131926830-131926852 CTATCAAGCAGGCACCCTGGTGG + Intergenic
1032840610 7:135710889-135710911 CTGTCACGAATGCCCCCTGGGGG + Intronic
1033257852 7:139817405-139817427 GTATCCAGAGACCCCCCTGCCGG + Intronic
1037389739 8:18380849-18380871 GTATCTAGCAGGCACCCTGGTGG - Intergenic
1038414061 8:27380414-27380436 GTAGCGAGAAATCCCCCTGCAGG - Intronic
1042490587 8:69393329-69393351 TTATAAAGAAAGAGCCCTGGGGG - Intergenic
1043360084 8:79461776-79461798 CTATCAAGAAAACAGCCTGGTGG - Intergenic
1046021129 8:108666456-108666478 GGGTCCAGGAAGCCCCCTGGTGG - Intronic
1052054809 9:23893057-23893079 GTATTAAGAAAGGCCTCTTGTGG - Intergenic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1056717771 9:89046884-89046906 GTATCAAGAAAGCCCCCTGGAGG + Exonic
1056932342 9:90889603-90889625 GTATCTAGAAACCACCCAGGGGG + Intronic
1057127684 9:92632002-92632024 TCACCAACAAAGCCCCCTGGAGG + Intronic
1058304291 9:103417966-103417988 GTATCAAGGAAGGGTCCTGGTGG + Intergenic
1058988138 9:110228571-110228593 GTAGTAAGAAAGACCACTGGAGG - Intergenic
1059179606 9:112199431-112199453 GTATCAGGAAGGCTTCCTGGAGG - Intergenic
1060524398 9:124312337-124312359 CTGTGCAGAAAGCCCCCTGGGGG + Intronic
1061400837 9:130367508-130367530 GCATCAAGAAGACCCCTTGGAGG - Intronic
1203740054 Un_GL000216v2:171068-171090 GTCTCACAAAAGCCCCCTGTGGG - Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1188113370 X:26217023-26217045 GGGTCAAGAGAGCCCACTGGAGG - Intronic
1190948914 X:55123216-55123238 GTTCCAAGGCAGCCCCCTGGAGG - Intronic
1194556506 X:95367345-95367367 GTATCATGAAACCCAACTGGGGG - Intergenic
1195928067 X:110046284-110046306 GGATAAAGAAGGCCCCCTGTTGG - Intronic
1200211391 X:154348225-154348247 GTGTCAGGAAGGCTCCCTGGTGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic