ID: 1056718296

View in Genome Browser
Species Human (GRCh38)
Location 9:89052106-89052128
Sequence CAGGATGTCATCGGCTCCAT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056718296_1056718305 17 Left 1056718296 9:89052106-89052128 CCGATGGAGCCGATGACATCCTG 0: 1
1: 0
2: 1
3: 11
4: 73
Right 1056718305 9:89052146-89052168 ATTCCAAAATGTGACAAGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 237
1056718296_1056718304 16 Left 1056718296 9:89052106-89052128 CCGATGGAGCCGATGACATCCTG 0: 1
1: 0
2: 1
3: 11
4: 73
Right 1056718304 9:89052145-89052167 CATTCCAAAATGTGACAAGCTGG 0: 1
1: 0
2: 1
3: 10
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056718296 Original CRISPR CAGGATGTCATCGGCTCCAT CGG (reversed) Exonic
904431459 1:30467217-30467239 CAGGGAGTCATCAGCCCCATTGG - Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906540748 1:46583909-46583931 GAGGATGCCGTAGGCTCCATAGG - Intronic
915304013 1:154967740-154967762 CAGGATGTCATCAGCACCATTGG - Exonic
915619365 1:157070573-157070595 CAGGCTGTCATCGTCTAGATGGG + Intergenic
916558625 1:165913924-165913946 CACCATGTCATAGGCACCATTGG - Intergenic
916657047 1:166885568-166885590 AAGGATGGCATCAGCTACATTGG - Intergenic
917981024 1:180269276-180269298 CAGGGTATCATGGGCTCCCTTGG + Intronic
1064692086 10:17928737-17928759 CAGGCTGTCATCGGCGTTATTGG + Intergenic
1066086004 10:31972530-31972552 TTGGAAGTCATCGGCTCCTTTGG - Intergenic
1068812187 10:61268590-61268612 CAGGACTTCATCGGCTCCTCTGG + Intergenic
1076632664 10:131860553-131860575 CAGGATTCCATCGGCTCTGTTGG + Intergenic
1078737828 11:14036880-14036902 AAGGATGACATAGGATCCATTGG + Intronic
1082088210 11:48067334-48067356 GAGGAAGTCATCCGCACCATTGG - Intronic
1084510389 11:69599794-69599816 CAGGAAGTTATCGGCTACCTGGG + Intergenic
1084536644 11:69761241-69761263 CAGGATGTCAGGGCGTCCATTGG - Intergenic
1090894058 11:130953607-130953629 CCTGATCTCATGGGCTCCATGGG + Intergenic
1093464782 12:19439034-19439056 CAGGATGTCAACATCTCCAGGGG + Intronic
1102614559 12:114142119-114142141 CAGGATGTGATCAGGTCCAAAGG - Intergenic
1106547349 13:30742335-30742357 CAGGATTTCATCAGCTCCACAGG - Intronic
1114954445 14:27799837-27799859 CATGATGTCATCGTTTCAATTGG + Intergenic
1121277192 14:92676481-92676503 CAGGAAGTCATCCGCCCCATAGG - Exonic
1122958665 14:105084436-105084458 AGGGATGTCATCCTCTCCATGGG + Intergenic
1132632539 16:926803-926825 CAGGATGTCAGCTGCTCCCCGGG + Intronic
1137624959 16:49901754-49901776 CAGGATGTCAGTGTCCCCATGGG + Intergenic
1138489383 16:57367243-57367265 CTGGATGCCATTGGCTCCAATGG - Intergenic
1139914761 16:70421197-70421219 CAGCATGTCATCGGCTCCTCAGG - Intronic
1142342732 16:89534558-89534580 CAGGAAGTCAACGGCTCTCTCGG - Intronic
1143199207 17:5100501-5100523 CAGGATGCCATGGGCTCCAGGGG - Intergenic
1147973003 17:44229864-44229886 CAGGATGTCATTAGCACCATTGG - Intergenic
1150205806 17:63406173-63406195 CATGTTGACATCAGCTCCATGGG - Exonic
1157285248 18:46373184-46373206 CAGGGTGTCATCTCCTTCATGGG + Intronic
1157428541 18:47604265-47604287 CAGGACCTCATCGCCTGCATTGG + Intergenic
1157729075 18:49988306-49988328 CAGGCTGTCCTCGGCCTCATGGG - Intronic
1160522439 18:79515549-79515571 CAGGAGGTCAAAAGCTCCATTGG - Intronic
1161403346 19:4078523-4078545 CAGGATGTCGGCCGCTCCTTTGG + Intergenic
1162445145 19:10718291-10718313 CAGGACGCCTTCAGCTCCATCGG + Exonic
1162802033 19:13116578-13116600 CACGAGGGCATCGGCTCCACAGG - Intronic
1163005442 19:14394366-14394388 CTGGATGTCACAGGCCCCATGGG - Intronic
934482866 2:94669455-94669477 CATGATGTCATCGTTTCAATTGG - Intergenic
934661098 2:96144153-96144175 CAGGAGGCCATAGGCTTCATTGG - Exonic
938696211 2:133837631-133837653 CAGGCTGTCCTCTGCTCCAGTGG + Intergenic
940638167 2:156322230-156322252 CAGGGCGCCATCGGCTCCCTGGG + Intergenic
946006898 2:216533097-216533119 CAGGATGTCATTGGGTGCCTCGG - Intronic
946169119 2:217883926-217883948 AAGGATGGCATCTGCTCCATGGG + Intronic
947801896 2:232933880-232933902 CAGGAAGCCATGGGCTCCTTAGG + Intronic
1170815697 20:19712407-19712429 CAGGACGACATCAGCACCATAGG + Intronic
1180786225 22:18549308-18549330 CAGGCTCGCCTCGGCTCCATGGG - Intergenic
1181131507 22:20735035-20735057 CAGGCTCGCCTCGGCTCCATGGG - Intronic
1181243147 22:21488862-21488884 CAGGCTCGCCTCGGCTCCATGGG - Intergenic
1183183466 22:36277684-36277706 CAGGATGTCTGCAGCTCCAGAGG + Intergenic
1184335546 22:43850850-43850872 CAGGATCTCAGCGGCACCATCGG - Intronic
1184393340 22:44218307-44218329 CAGGATGTCATTGGGACCAAGGG + Intronic
956671514 3:71695950-71695972 CAGGTTCTCATCGGCCCCAGAGG + Intronic
959236534 3:103729766-103729788 CATGATGTCATCTTCTGCATAGG + Intergenic
969121471 4:4914530-4914552 CAGGAAGTCATCACCTCCTTTGG + Intergenic
969242458 4:5909057-5909079 CAGGATGTCATCAGCTTCCTAGG - Intronic
982693399 4:158572715-158572737 CAGGATGTCAAGTGCTCCCTTGG + Exonic
996303083 5:122011581-122011603 CAGAATGTGATAGGCTTCATAGG - Intronic
998210674 5:140194857-140194879 CAGGAAGTCATCAGCCCCAGAGG - Intronic
1000744689 5:165018283-165018305 CAAGATGTCATTCTCTCCATAGG - Intergenic
1001319384 5:170667955-170667977 CAGAATCTCATTGGCTCCAATGG + Intronic
1001330618 5:170759953-170759975 CAGGATGACCCCGGCACCATGGG - Intergenic
1005870357 6:29970838-29970860 CAGAGGGTCATCTGCTCCATGGG - Intergenic
1006115907 6:31776126-31776148 CAGGAAGTCCTGGGCTGCATTGG + Exonic
1013465296 6:110412672-110412694 CAGGATGACAGCTGCTCCATCGG + Intronic
1027635151 7:80662433-80662455 CAGCATTTCATCCGCACCATTGG + Intronic
1028619023 7:92803399-92803421 CTGGCTGTCATCAGCTCCATGGG - Intronic
1046717110 8:117579944-117579966 CAGGATGTCATCAGCTGGCTTGG - Intergenic
1047821298 8:128524452-128524474 CAGGGTGTCATCAGGTCCTTAGG - Intergenic
1049683826 8:143931358-143931380 CAGGATGTTCTGGGCTGCATGGG - Intronic
1053674964 9:40415266-40415288 CATGATGTCATCGTTTCAATTGG + Intergenic
1053924755 9:43041625-43041647 CATGATGTCATCGTTTCAATTGG + Intergenic
1054386066 9:64555333-64555355 CATGATGTCATCGTTTCAATTGG + Intergenic
1054509655 9:65961027-65961049 CATGATGTCATCGTTTCAATTGG - Intergenic
1055652190 9:78417406-78417428 CAAGATGTCATAGGCACCTTGGG + Intergenic
1056718296 9:89052106-89052128 CAGGATGTCATCGGCTCCATCGG - Exonic
1061684336 9:132262601-132262623 CAGGAAGTCACCTGCTCCCTGGG + Exonic
1203782766 EBV:110004-110026 TAGGAGGTCATCTCCTCCATGGG + Intergenic
1186101139 X:6157754-6157776 CATGATCTCATCAGCTCCAAAGG + Intronic
1186347092 X:8704696-8704718 CAGCATGTCATAGGCTGCTTGGG + Intronic
1188369345 X:29349582-29349604 CAGGATGTCATAGACTCGTTGGG - Intronic
1188570385 X:31578380-31578402 CAGGATGGCATGGGCTGCAGTGG - Intronic
1191740686 X:64433291-64433313 CAGGATGTCATCAGCACCACTGG + Intergenic
1194983284 X:100462151-100462173 CAGGATGTCATTGAAACCATGGG - Intergenic
1200230187 X:154440087-154440109 CAGGATGTCATCGATTTCACTGG + Exonic