ID: 1056718766

View in Genome Browser
Species Human (GRCh38)
Location 9:89055632-89055654
Sequence AGCAGAACAGAAGGTGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 226}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056718766_1056718771 6 Left 1056718766 9:89055632-89055654 CCAAATGCACCTTCTGTTCTGCT 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1056718771 9:89055661-89055683 CCGTCACACAGAACTGTCATGGG No data
1056718766_1056718776 27 Left 1056718766 9:89055632-89055654 CCAAATGCACCTTCTGTTCTGCT 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1056718776 9:89055682-89055704 GGCTTCTCCCAAGCAGGAGGGGG No data
1056718766_1056718772 21 Left 1056718766 9:89055632-89055654 CCAAATGCACCTTCTGTTCTGCT 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1056718772 9:89055676-89055698 GTCATGGGCTTCTCCCAAGCAGG No data
1056718766_1056718769 5 Left 1056718766 9:89055632-89055654 CCAAATGCACCTTCTGTTCTGCT 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1056718769 9:89055660-89055682 CCCGTCACACAGAACTGTCATGG No data
1056718766_1056718775 26 Left 1056718766 9:89055632-89055654 CCAAATGCACCTTCTGTTCTGCT 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1056718775 9:89055681-89055703 GGGCTTCTCCCAAGCAGGAGGGG No data
1056718766_1056718773 24 Left 1056718766 9:89055632-89055654 CCAAATGCACCTTCTGTTCTGCT 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1056718773 9:89055679-89055701 ATGGGCTTCTCCCAAGCAGGAGG No data
1056718766_1056718774 25 Left 1056718766 9:89055632-89055654 CCAAATGCACCTTCTGTTCTGCT 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1056718774 9:89055680-89055702 TGGGCTTCTCCCAAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056718766 Original CRISPR AGCAGAACAGAAGGTGCATT TGG (reversed) Intronic
900823918 1:4911271-4911293 AACAGAACAGAAAGGGCATGAGG - Intergenic
901632788 1:10656063-10656085 AGGAGCACAGATGATGCATTGGG + Intronic
904950775 1:34236873-34236895 AGCAGAAGAGAAGGGGGATGTGG - Intergenic
905732478 1:40306233-40306255 AGCAAAGCAGCAGGTGCATGGGG - Intronic
905966499 1:42102915-42102937 AGCAGAATAGTAGCTGCCTTTGG + Intergenic
907544726 1:55249831-55249853 AGAAGCACAGATGGTGCATGTGG - Intergenic
908036108 1:60055501-60055523 ATAAGAACAGAAGGTGTGTTTGG + Intronic
908865028 1:68538063-68538085 AGTATAACAGAAGGTTCATATGG - Intergenic
911952548 1:104193789-104193811 AACAGATCAGAAGTTACATTTGG - Intergenic
913194401 1:116443580-116443602 AGTACAACAGAAGGTACCTTTGG - Intergenic
915273925 1:154775132-154775154 AGCAGAGCAGAAGCTTCCTTTGG - Intronic
916139092 1:161677745-161677767 TGAAGCACAGAAGGTGCAGTCGG - Exonic
916771702 1:167915312-167915334 AGCAGAAAAGAAGCTGCTTGGGG - Intergenic
918085091 1:181238292-181238314 AGCAGGACAGAAGGTGGAGAAGG + Intergenic
918531142 1:185523987-185524009 AGCAGTACAGAAGGTAAATGTGG - Intergenic
918537999 1:185595746-185595768 AGGAAAACAGAAACTGCATTGGG + Intergenic
918594945 1:186282413-186282435 AGCAGAAAAGCAGGTGGATGGGG + Intergenic
921245563 1:213235667-213235689 AGCAGAACAGAAAGAGCAGTAGG + Intronic
923977861 1:239284826-239284848 AGAAGAACAGAAGGTTCAAGTGG - Intergenic
924013275 1:239690970-239690992 AGCAGAACAGCAGATACCTTTGG + Intronic
1063342344 10:5278319-5278341 AGCATTTCAGAAGGTGCATGGGG - Intergenic
1064411505 10:15108751-15108773 AACAGAACAAAAGATCCATTTGG - Exonic
1065268162 10:23998947-23998969 AGCACAACAGATGGTATATTTGG + Intronic
1066539538 10:36430594-36430616 ATCAGAACACTAGTTGCATTCGG - Intergenic
1068627380 10:59263966-59263988 AGCAGAAAACAAGGTGCAAGAGG + Intronic
1068810153 10:61246285-61246307 AGCAGAACAGAAATTAAATTGGG - Intergenic
1071034333 10:81224905-81224927 GGGAGAACAGAAGGTGAATTAGG + Intergenic
1071095445 10:81968822-81968844 ACCAGAAGAGAAGGTGCAGGTGG - Intronic
1072686226 10:97538987-97539009 CGCAGATCACATGGTGCATTAGG + Intronic
1073129213 10:101175913-101175935 AGCAGAAGAGGATGTGCCTTTGG + Intergenic
1073602526 10:104861031-104861053 ACCAGAACAGGCAGTGCATTTGG - Intronic
1073959384 10:108909012-108909034 CCCGGAACAGAAGATGCATTGGG + Intergenic
1074033392 10:109712058-109712080 AGCAGAACAGTAGTTGCCTGGGG - Intergenic
1074681125 10:115908787-115908809 AGCAGAATGTAAGGTGCATTAGG - Intronic
1075578766 10:123600144-123600166 ATAAGAGCAGAAGATGCATTTGG - Intergenic
1076276902 10:129207782-129207804 AGCAGCACAGAAGGTGGCTCCGG + Intergenic
1077529359 11:3087944-3087966 CGCACAGCAGAAGCTGCATTTGG + Exonic
1080008627 11:27435460-27435482 AACAGAACAGAAGAGGCACTTGG - Intronic
1080015860 11:27506404-27506426 AGCACAGCAGAAGCAGCATTCGG - Intronic
1080715854 11:34799158-34799180 AGTAGAAAAGCAGGTGCAGTGGG - Intergenic
1081695674 11:45107522-45107544 AGCAGAACAGAGGGTGGATGGGG + Intronic
1082013384 11:47466383-47466405 TGCAGAACAGACTGTGCGTTTGG + Intronic
1084283707 11:68117831-68117853 ACTAGAACAGGAGGTGCCTTAGG - Intronic
1085374270 11:76044261-76044283 AGAAGAAGAGAATGGGCATTGGG + Intronic
1085477486 11:76797326-76797348 AGGAGACAAGAAAGTGCATTGGG - Exonic
1089168711 11:116498028-116498050 GGCAGAGCAGCAGGTGTATTTGG - Intergenic
1089588099 11:119522693-119522715 AGCAGAGCAGAAGGAGCAGCAGG - Intergenic
1090116362 11:123978438-123978460 AGCCTAACAGATGTTGCATTAGG + Intergenic
1090344503 11:126058277-126058299 AGCAGAACAAAATGTTCTTTGGG + Intronic
1091033044 11:132208596-132208618 AGCAGGACAGAAGGTGGTTTGGG - Intronic
1091910913 12:4230030-4230052 GGCAGAACAGACAGTGCCTTGGG - Intergenic
1092000537 12:5027990-5028012 ATCAGGATAGGAGGTGCATTTGG + Intergenic
1092149372 12:6236583-6236605 AGAAGAACAGCAGGTGCGTGAGG - Intronic
1092283253 12:7113509-7113531 AGGACAACAGAAAGTGCCTTGGG + Intergenic
1092701682 12:11238494-11238516 AGCAGACCAGAAGCTGGGTTGGG - Intergenic
1095447480 12:42296615-42296637 AGCAGAAAACAGGGTGAATTTGG - Intronic
1095670803 12:44857884-44857906 AGTAGAACAGAAGATGCTTTAGG + Intronic
1098043266 12:66373557-66373579 AGCTGAACACCAGGTGAATTTGG - Intronic
1098087580 12:66863681-66863703 AGGAGAGCAGAAGATGCAGTGGG + Intergenic
1098212499 12:68181404-68181426 AGGAAAACAGAAGCTGCTTTAGG - Intergenic
1103075337 12:117977765-117977787 AGCAGAATTGAAGGGTCATTTGG + Intergenic
1103460324 12:121098808-121098830 AGCAAAACAGCATGTGCCTTCGG - Intergenic
1104349064 12:128029162-128029184 AGGAGGAAAGAAGGTGAATTTGG + Intergenic
1104997572 12:132668222-132668244 AGCAGACCAGAAGCTGCTCTAGG - Intronic
1106991773 13:35428475-35428497 AGCAGAACAGAAGGAACAGAGGG - Intronic
1110114793 13:71799612-71799634 AAAAGAACAGTAGGTTCATTCGG + Intronic
1112689913 13:101880825-101880847 AACAAAACAGAAAGTGAATTCGG - Intronic
1113392458 13:109910494-109910516 AGCAGAACAGAAAATGCCTAAGG - Intergenic
1114501579 14:23173237-23173259 CGCAGAGCAGAAGCTGCATGAGG + Intronic
1114618337 14:24080400-24080422 AGCAGGATAGGAGGTGCCTTTGG + Exonic
1114834788 14:26191220-26191242 AGCTGAACAGCAAGTGGATTTGG - Intergenic
1117018719 14:51547549-51547571 ACCAGACCAGGAGATGCATTTGG - Intronic
1120093670 14:80363551-80363573 AGCACACTAGAAGGTACATTTGG - Intronic
1122804629 14:104250266-104250288 GGCAGAGTAGGAGGTGCATTGGG + Intergenic
1124268331 15:28257295-28257317 AGCAGACCAGCAGCTGCATTTGG - Intronic
1125680066 15:41524942-41524964 AGCAGAACTGAAGGTGTCTAGGG + Intronic
1126292172 15:47094172-47094194 AACAGAATAGAAAGTCCATTGGG + Intergenic
1126846934 15:52769132-52769154 AGCAGAAAAGAAGATGCTTGAGG - Intronic
1128940395 15:71783415-71783437 AGGAGAACAGAACGTGAATAAGG - Intergenic
1129703595 15:77782116-77782138 TACAGAACAGAAGGAACATTTGG + Intronic
1129875595 15:78973491-78973513 AGCAAAGCAAAAGGTGCATGCGG - Intronic
1130327097 15:82889823-82889845 AGCAGGGCTGAATGTGCATTGGG + Intronic
1131538033 15:93253738-93253760 TGCAGAACAGGAGGTTCATCTGG + Intergenic
1132092590 15:98958152-98958174 AGCAGCACAGCAGGGGCAGTCGG - Exonic
1137026570 16:35482081-35482103 AGCAGAACACGAGATGCATAGGG + Intergenic
1138271643 16:55699883-55699905 GGAAGAACAGAAGGTGACTTTGG - Intronic
1142124959 16:88405639-88405661 AGCAGAGCAGAGGGTGCAGCTGG + Intergenic
1143693736 17:8594330-8594352 AGCACATCAAAAGATGCATTAGG + Intronic
1144164793 17:12599921-12599943 AGCAAAAAAGAAGATACATTAGG + Intergenic
1144384457 17:14736550-14736572 AGGAGAACAGTAGGTGCAGGGGG + Intergenic
1144404167 17:14936472-14936494 TCCAGAACAGCAGGTGCAATTGG + Intergenic
1145859249 17:28193596-28193618 AGCAGGACAAAGGGTGGATTCGG + Intronic
1145934986 17:28710028-28710050 AGCTGAAAAGCAGGTGCAGTAGG - Intronic
1146522821 17:33539499-33539521 AACAGGAAAGAATGTGCATTTGG - Intronic
1146788199 17:35735958-35735980 AGCAGAACAGACGGGGCCCTGGG + Intronic
1149414511 17:56445268-56445290 TGCAGATCAGAACTTGCATTTGG - Intronic
1150042862 17:61881950-61881972 AGGAGAAAAGAATGTCCATTTGG + Intronic
1150199099 17:63334943-63334965 AGCAGAGCAGGAGGTGGGTTGGG + Intronic
1152119742 17:78411205-78411227 TGCAGAACAGCAGGGGCACTGGG + Intronic
1154265949 18:12879122-12879144 AGCAAAACAAAGGGTGCAGTTGG - Intronic
1156411637 18:36834251-36834273 TACAGAACAGAAGCAGCATTTGG + Intronic
1159291059 18:66420526-66420548 ACCAGAAAAGATGGTGGATTGGG + Intergenic
1159979664 18:74762602-74762624 AGCAGATCAGCAGTTGCATAGGG - Intronic
1160410429 18:78672065-78672087 AATAGAACAGAATGTGGATTGGG + Intergenic
1160914039 19:1488282-1488304 TGCAGAGCAGAGGGTGCATCAGG + Intronic
1164439144 19:28258784-28258806 AGCAGAACAGCCTGTGCAATGGG + Intergenic
1165243890 19:34486878-34486900 AGGAGAACTGAAGGTGCAGGAGG - Intronic
1165407466 19:35639456-35639478 AGCAGAACAGCAGGTACACGTGG + Intergenic
1167128319 19:47567127-47567149 AGTAGCACAGAAAGTGCTTTTGG - Intergenic
1167530201 19:50011091-50011113 AGCAGTACAGGAGTTGCAATTGG - Intronic
925724080 2:6856136-6856158 AGCAGAACTGCAGGGGCATGGGG - Intronic
926019696 2:9484226-9484248 AGCAGAGGACAAGGTGCAGTGGG - Intronic
929332143 2:40694978-40695000 AGAAGAACAGAAGATGTATTGGG + Intergenic
930264859 2:49187473-49187495 AGCAGAATATAAGGTCCATGAGG + Intergenic
931690694 2:64832422-64832444 AGCAGAACAAAGGGAGGATTAGG + Intergenic
932071749 2:68627561-68627583 TGCAGAATAGATGGAGCATTTGG + Intronic
933417333 2:82002866-82002888 GGCAGAGCAGAAGGAGAATTAGG - Intergenic
936055686 2:109260393-109260415 AGCAGGAGAGCAGGTGCAGTTGG + Intronic
937830050 2:126409764-126409786 AGAGGAACAGAAGATGCTTTTGG + Intergenic
938393106 2:130920496-130920518 AGGAGAACAGCAGGTACATAGGG + Intronic
939203601 2:139071236-139071258 AGCAGAACAGCAGGTGAGTGAGG - Intergenic
939763230 2:146211142-146211164 AGAAGAACAGAGGGTACATGGGG + Intergenic
940236704 2:151518876-151518898 AGCAGAGAAGAAGATGCATCTGG + Intronic
940732901 2:157414968-157414990 GGCAGAACAAAAGCTGAATTGGG + Exonic
942983589 2:182112041-182112063 AGTAAAACAAATGGTGCATTAGG - Intronic
943115411 2:183663691-183663713 GGAGGAACAGAAGATGCATTTGG + Intergenic
944203678 2:197135291-197135313 AGCAGAGGAGAAGCTGCATTTGG + Intronic
945093398 2:206197207-206197229 AGCAGTAAAGAATATGCATTTGG - Intronic
948276631 2:236714055-236714077 AGCAGAAGAGAAGGGGCCATGGG + Intergenic
948280191 2:236740906-236740928 ACCTGAAGAGAAGGTGCCTTAGG - Intergenic
948609607 2:239158561-239158583 AGCAGAGCAGCAGGTGCAGGAGG + Intronic
948853609 2:240720008-240720030 AGCACCTCAGAAGGTGCAGTAGG + Intronic
949000155 2:241608747-241608769 TGCAGAACTGAATGTACATTAGG + Intronic
1168819910 20:765744-765766 CGCAGACCAGCAGGTGCATCAGG + Exonic
1169024458 20:2357259-2357281 AGCAGAAGTGAAGGAGCATTAGG - Intergenic
1172438824 20:34950830-34950852 ACCAAAACACAAGCTGCATTAGG + Intronic
1174931214 20:54817344-54817366 AGCTGAACAGAAGCTGCAGCTGG + Intergenic
1175569740 20:60009801-60009823 AGCAAAACAGAATCTGCAGTGGG - Intronic
1177405902 21:20667742-20667764 GGCAGAACAAAAGGTGAACTTGG - Intergenic
1177634546 21:23770707-23770729 TGGAGACCAGAAGGTGAATTGGG - Intergenic
1177767093 21:25471422-25471444 AGAAGATCTGAAAGTGCATTGGG + Intergenic
1178123283 21:29491349-29491371 ATCATAACAGAAGGTGCAGCAGG - Intronic
1178430586 21:32515240-32515262 ACCAGAACTGGAGGGGCATTTGG - Exonic
1178477533 21:32950463-32950485 AGCAGAACAGAATTGACATTGGG + Intergenic
1180106360 21:45620835-45620857 AGCAGAGAAGAAGGTGCAGTCGG - Intergenic
1180703150 22:17792713-17792735 AGCAGAACCGCATGTGCACTAGG - Intronic
1183256425 22:36765349-36765371 AGCAGAAGGGAAGATGTATTAGG - Intronic
951458325 3:22919304-22919326 AGAATAACAGAAAGTACATTTGG + Intergenic
951690028 3:25385728-25385750 AGGAGAACAGAAGGAGCGTAGGG - Intronic
951900426 3:27652711-27652733 TGCAGAACAGCATGTACATTAGG + Intergenic
952781960 3:37109543-37109565 AGCAGACCAGAATTTGCAGTAGG + Exonic
952978677 3:38718031-38718053 AAAAGAACAGAGGGCGCATTTGG - Intronic
953869100 3:46610719-46610741 AACAGAACAGAAAATGCTTTTGG - Intronic
954853010 3:53619093-53619115 AGCATAACAGTAGGTCCATTGGG + Intronic
954921709 3:54196808-54196830 AGCAGAACTGCATCTGCATTTGG - Intronic
955193995 3:56788043-56788065 AGGAGGACAGAATGTTCATTTGG + Intronic
955844316 3:63145661-63145683 TGTAGAACAGACTGTGCATTAGG - Intergenic
958437456 3:94114548-94114570 AAGAGAACAGAATGTGGATTTGG - Intronic
959905511 3:111707126-111707148 AGAGGAACAGAATGTGCGTTTGG + Intronic
962922383 3:139962460-139962482 AGCAGAACAGTAGTTGCTTATGG - Intronic
963873182 3:150442105-150442127 AAAAGAACAGTAGGTGCAGTTGG - Intronic
963955886 3:151253416-151253438 GGGAGAACAGAAGGTGTGTTTGG - Intronic
966163887 3:176995507-176995529 AGCAGAAAGGAAGGAGGATTTGG - Intergenic
967584836 3:191199773-191199795 AGAAAAACAGAAGATGCATTAGG - Intronic
967710816 3:192705980-192706002 ATCACAACAGAATGTGCTTTAGG + Intronic
969684642 4:8664335-8664357 AGCAGAAAAGAAGTTGGACTGGG + Intergenic
971572484 4:28231160-28231182 AAAAGAAAGGAAGGTGCATTTGG + Intergenic
972724493 4:41734504-41734526 AGCACAACAGAAGCTGCCTGGGG - Intergenic
975104909 4:70556643-70556665 AGGATAACAGAGGGGGCATTTGG + Intergenic
975669754 4:76769016-76769038 AGCACCAGAGAAGGTCCATTAGG - Intronic
976507944 4:85871388-85871410 GGTAGAAAAGAAGGTGTATTGGG - Intronic
977961384 4:103088961-103088983 ACCAGAAGAGAAGATCCATTAGG - Intronic
978090740 4:104711676-104711698 AACAGAACAGAGGCTGCAATGGG + Intergenic
980444264 4:132885893-132885915 AGCAGAACTGAAGGTGCTGGGGG + Intergenic
980519345 4:133910436-133910458 AGCAGCACAGAAACTGCAGTAGG - Intergenic
983654530 4:170069304-170069326 AGTAGAACAGGAGATGGATTTGG + Intronic
985481367 5:113023-113045 AGCAGAGGGGCAGGTGCATTAGG - Intergenic
986007063 5:3677230-3677252 AGCAGCTCAGGAGGGGCATTCGG + Intergenic
986018157 5:3775710-3775732 AGAAGAGATGAAGGTGCATTTGG + Intergenic
987132782 5:14873621-14873643 AGCAAAACAGGAGGTTCATGTGG + Intergenic
988514418 5:31892272-31892294 AGCAGAGCAATAGGTACATTAGG - Intronic
989595973 5:43156520-43156542 AGCAGCACAGAAGCTGCACGTGG + Intronic
990163083 5:52964763-52964785 AGCAGAACAGAAGCTACAGCTGG - Intergenic
990472103 5:56125198-56125220 AGAAGAACATAAGCTACATTAGG - Intronic
994183906 5:96798001-96798023 AGCAGAACAGAAGCTCTTTTAGG - Intronic
995243322 5:109910128-109910150 ACCAGAACAGAATGTGTAATGGG - Intergenic
1001007226 5:168063495-168063517 GGAAGAACATAAGGTACATTAGG + Intronic
1004161871 6:13221407-13221429 AGCAGAATAGAGGGTGGACTGGG + Intronic
1006524481 6:34591927-34591949 AGCAGCATAGAAAGTGCCTTTGG - Intronic
1007722349 6:43892487-43892509 AGCAGACCAGAAGGTGGCTAAGG + Intergenic
1008783602 6:55138910-55138932 AACAGGACAGAAAGTGCCTTTGG + Intronic
1011219843 6:85042690-85042712 AGCAGAACAGCAAGTGCAAAGGG - Intergenic
1012314206 6:97765338-97765360 AGCATAACATAAAGTGCATTAGG - Intergenic
1013140635 6:107330348-107330370 AGAAGAAAAGAAAGTGCGTTTGG + Intronic
1015051248 6:128842827-128842849 AACAGTACAGAAGCTGCAGTGGG + Intergenic
1015255225 6:131171651-131171673 AGCAATGCAGAAGCTGCATTTGG + Intronic
1017902242 6:158728428-158728450 AGCAGAACAGAGAGTCCATAAGG - Intronic
1018258614 6:161947877-161947899 GGCATAACAGAAGGTGCCTCTGG - Intronic
1018863688 6:167731582-167731604 AGCAGGAAAGAAAGTACATTCGG - Intergenic
1019997384 7:4733627-4733649 AGCAGGAGAGAAGGTGCTCTGGG + Intronic
1022212870 7:28228453-28228475 ATCAGAACAGAAGGAATATTAGG - Intergenic
1022589532 7:31648272-31648294 AGTAGAGCAGAACTTGCATTTGG + Intronic
1023122372 7:36922885-36922907 AGAAAGACAGGAGGTGCATTGGG - Intronic
1023361158 7:39416451-39416473 AGCACAACAGAAGATTCACTGGG - Intronic
1023958297 7:44905561-44905583 GGCAGGACAGAAGCTGCAGTGGG - Intergenic
1024641710 7:51334341-51334363 AGCAGATCAGATGGTGCTTGAGG - Intergenic
1027571237 7:79870054-79870076 AGCAGGATAGAGGATGCATTTGG + Intergenic
1028239696 7:88404641-88404663 AGGAGAAGATAAGGTGAATTTGG + Intergenic
1028500627 7:91515266-91515288 AACAGAACAAAAGCAGCATTGGG - Intergenic
1030284535 7:107812091-107812113 ATCAGAACAGAAGTTGCCTCTGG - Intergenic
1031374362 7:121006107-121006129 AGCAGAAAGGAAAGAGCATTGGG - Intronic
1034895442 7:154873380-154873402 TACAGACCAGGAGGTGCATTGGG - Intronic
1036576478 8:10032074-10032096 ATCAGAACACAGGGTGCATGAGG - Intergenic
1038254816 8:25941589-25941611 TCCAGAAAAGAAGGTGCAATGGG + Intronic
1038291079 8:26250485-26250507 AGCAGAGCAGAAGGTTCCTGTGG + Intergenic
1038399489 8:27272127-27272149 AGTAGAAGAGAAGGAGCATGGGG - Intergenic
1038763789 8:30408874-30408896 AGCAGATCAGCAGTTGCTTTGGG - Intronic
1043202293 8:77385466-77385488 TGCAAAAAAGAAGGTGCTTTGGG - Intergenic
1043585115 8:81759809-81759831 AGGAGAACAGAATGTGCAAAAGG - Intergenic
1043618514 8:82158653-82158675 AGCAGAACAGAATGTGAGTCAGG - Intergenic
1045997862 8:108384448-108384470 AGCAAAGCAAATGGTGCATTAGG + Intronic
1046803648 8:118456114-118456136 AGAAGAGTAGAAGATGCATTAGG - Intronic
1047597777 8:126395931-126395953 AGCTAAACAGAATGTACATTTGG - Intergenic
1049627547 8:143632534-143632556 AGAAGAACAGAAGGTCACTTTGG - Intergenic
1049665904 8:143842381-143842403 CGCAGCCCAGAGGGTGCATTCGG + Intergenic
1051399159 9:16660523-16660545 AGCAGAACATAAGCTGCCTAAGG + Intronic
1056718766 9:89055632-89055654 AGCAGAACAGAAGGTGCATTTGG - Intronic
1059485606 9:114624322-114624344 AGCAGACCAGAAGCTTCATCTGG - Intronic
1059653156 9:116334112-116334134 AGCAAAACAGAAGTTGGCTTTGG - Intronic
1060906724 9:127313707-127313729 TGCAGAAAATAAGGTGCTTTGGG - Intronic
1186140451 X:6566753-6566775 AGCTAAACAGTAGGTGCATATGG + Intergenic
1186753966 X:12650311-12650333 AGCAGAACAGAGGATGCCTCAGG - Intronic
1187216083 X:17277962-17277984 ACCAGACCAGAACGTCCATTTGG - Intergenic
1187945021 X:24417429-24417451 AGGAGCACAGAAGGTGCTTGTGG + Intergenic
1188422115 X:30003039-30003061 AAAAGAATTGAAGGTGCATTTGG - Intergenic
1192103716 X:68292859-68292881 ACCACAGCAGAAGGTGCATTGGG + Intronic
1192537346 X:71939366-71939388 AGCAGTATAGAAGGTGGGTTAGG + Intergenic
1194390137 X:93307355-93307377 AGCAGAAAAAAACATGCATTTGG - Intergenic
1194560970 X:95419832-95419854 AGCAGAAGAGAAAGTGTAATTGG - Intergenic
1195291907 X:103437844-103437866 GGCAGAACAGGAAGTCCATTCGG - Intergenic
1195968369 X:110449525-110449547 AGCAGCCCAGAAGGGGCTTTTGG - Intronic
1201519155 Y:14853004-14853026 TTCAGAACTCAAGGTGCATTAGG - Intergenic