ID: 1056718767

View in Genome Browser
Species Human (GRCh38)
Location 9:89055641-89055663
Sequence CGGGCTAAGAGCAGAACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 143}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056718767_1056718773 15 Left 1056718767 9:89055641-89055663 CCTTCTGTTCTGCTCTTAGCCCG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1056718773 9:89055679-89055701 ATGGGCTTCTCCCAAGCAGGAGG No data
1056718767_1056718776 18 Left 1056718767 9:89055641-89055663 CCTTCTGTTCTGCTCTTAGCCCG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1056718776 9:89055682-89055704 GGCTTCTCCCAAGCAGGAGGGGG No data
1056718767_1056718774 16 Left 1056718767 9:89055641-89055663 CCTTCTGTTCTGCTCTTAGCCCG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1056718774 9:89055680-89055702 TGGGCTTCTCCCAAGCAGGAGGG No data
1056718767_1056718777 22 Left 1056718767 9:89055641-89055663 CCTTCTGTTCTGCTCTTAGCCCG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1056718777 9:89055686-89055708 TCTCCCAAGCAGGAGGGGGCTGG No data
1056718767_1056718771 -3 Left 1056718767 9:89055641-89055663 CCTTCTGTTCTGCTCTTAGCCCG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1056718771 9:89055661-89055683 CCGTCACACAGAACTGTCATGGG No data
1056718767_1056718775 17 Left 1056718767 9:89055641-89055663 CCTTCTGTTCTGCTCTTAGCCCG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1056718775 9:89055681-89055703 GGGCTTCTCCCAAGCAGGAGGGG No data
1056718767_1056718769 -4 Left 1056718767 9:89055641-89055663 CCTTCTGTTCTGCTCTTAGCCCG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1056718769 9:89055660-89055682 CCCGTCACACAGAACTGTCATGG No data
1056718767_1056718772 12 Left 1056718767 9:89055641-89055663 CCTTCTGTTCTGCTCTTAGCCCG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1056718772 9:89055676-89055698 GTCATGGGCTTCTCCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056718767 Original CRISPR CGGGCTAAGAGCAGAACAGA AGG (reversed) Intronic
903008636 1:20315075-20315097 TGGGCTAAGAGTATAAAAGACGG + Intronic
905867705 1:41385230-41385252 CTGGCTGAGAGGAGAAGAGAAGG + Intergenic
907582227 1:55582671-55582693 ATGGCTGAGAGCCGAACAGAGGG + Intergenic
909400481 1:75223291-75223313 CAGGCTGAGAACAGAGCAGATGG - Intronic
910909035 1:92214525-92214547 CGTGTCAAGAGCAGAACAGGTGG + Intergenic
917158331 1:172028561-172028583 TAGGATAAGAGCAGAACTGAAGG + Intronic
917780794 1:178393980-178394002 TGGGATAAGAGCAGAATGGATGG + Intronic
918351046 1:183656219-183656241 CGGGGAAAGAGCAGAACAGTTGG - Intronic
919872034 1:201829191-201829213 CGGGCTGAGGGGAGAAAAGATGG + Exonic
920053919 1:203179422-203179444 CGTGCTGTGTGCAGAACAGAGGG + Exonic
921896895 1:220411251-220411273 TGGGCTAAGAGCAGAACTGCTGG + Intergenic
923977862 1:239284835-239284857 CTGTCAAAGAGAAGAACAGAAGG - Intergenic
1064903740 10:20321678-20321700 CTGGGAAAGAGCAGAACAGTGGG + Intergenic
1071614932 10:87066606-87066628 CCGTCTAAGTGCAGACCAGAAGG + Intronic
1072712618 10:97726686-97726708 CGAGCTCAGTGCAGAGCAGATGG - Intergenic
1073307318 10:102513595-102513617 CGGTCTGGGAGCAGAGCAGAGGG + Intronic
1076351124 10:129815951-129815973 CGGGCTCTGAGCACAGCAGAGGG - Intergenic
1080374835 11:31696165-31696187 TAAGATAAGAGCAGAACAGAAGG - Intronic
1085949438 11:81311607-81311629 CAAGATAAGAGAAGAACAGAAGG - Intergenic
1088736592 11:112732701-112732723 GAGGCTGAGAGCAGAACACATGG + Intergenic
1091640239 12:2230506-2230528 AAGGCTAAGAGGAGAACAGAAGG + Intronic
1096871531 12:54595650-54595672 CGGGCTAGGGGCAGAGCAGGAGG - Intergenic
1099488064 12:83252544-83252566 CTGGCTCAGAGTATAACAGAAGG + Intergenic
1099555062 12:84100557-84100579 TGAGATCAGAGCAGAACAGAAGG + Intergenic
1102491098 12:113290005-113290027 CAGGCTGCGGGCAGAACAGAAGG + Intronic
1104371188 12:128225255-128225277 TGGGCTGAGAGAAGAGCAGAGGG + Intergenic
1106599662 13:31176728-31176750 AGGGCTAGCAGCAGACCAGAAGG + Intergenic
1108062246 13:46544987-46545009 TCTGCTAAGAGCAGAACAGGAGG - Intergenic
1110762385 13:79244760-79244782 TGGGCAAAGACAAGAACAGAAGG + Intergenic
1111832193 13:93343343-93343365 CTGGCCAAGAGCTGAACAGATGG - Intronic
1112041264 13:95551047-95551069 GGGGTTCAGAGCAGAACAGTAGG + Intronic
1113480438 13:110616099-110616121 CGGGGACAGAGCAGAGCAGACGG - Intronic
1113906221 13:113820414-113820436 CAGGCTGGGAGCAGAAAAGAGGG + Intergenic
1114407357 14:22469158-22469180 GGGGATAACAGCAGATCAGAAGG - Intergenic
1116064565 14:39966483-39966505 CAGGCTGACAGCAGAACACATGG + Intergenic
1117029513 14:51653214-51653236 CGGTCCCAGAGAAGAACAGAAGG - Intronic
1117346068 14:54834025-54834047 CTGGCTAAGAGCAGACTGGAAGG - Intergenic
1118328626 14:64798837-64798859 GGGGGGAAGAGCAGAGCAGAAGG + Intronic
1118859815 14:69654044-69654066 CGGGACAGGTGCAGAACAGACGG - Intronic
1120003486 14:79330355-79330377 GGGGCTGAGAGAAGAAAAGATGG + Intronic
1120533221 14:85659228-85659250 AGGGATAATAGAAGAACAGAGGG + Intergenic
1122244569 14:100393466-100393488 CGGGCTAACAGCAACACAGCAGG - Intronic
1124593995 15:31078667-31078689 CGGGAAAAGTGCAAAACAGAAGG - Intronic
1129566630 15:76630296-76630318 CAAGCTCAGAGCAGAACTGAAGG - Intronic
1134413001 16:14018973-14018995 CAGGCTAAGAGAGGAAGAGAAGG - Intergenic
1137700971 16:50497488-50497510 TGGGCTATGAGAAGAAAAGACGG - Intergenic
1137915417 16:52424655-52424677 CGGGGGAAGAGCAGAAGACATGG - Intergenic
1138106153 16:54287996-54288018 CGGGATCAGAGGAGATCAGAGGG + Intergenic
1140223985 16:73064345-73064367 AGGGCCAAGAGCAGACCAGCTGG + Intergenic
1140406411 16:74714156-74714178 CGGGCTGAGGGCAGGACGGAGGG + Exonic
1140843785 16:78867087-78867109 TGAGCTAAGAACATAACAGAAGG - Intronic
1141190545 16:81821592-81821614 CTGGCTCAGAGCAGCACACAAGG - Intronic
1141606074 16:85154117-85154139 GGGGCTCAGTGCAGAACACAGGG - Intergenic
1141610108 16:85176487-85176509 CCGGCTAAGACCTCAACAGATGG - Intronic
1145116167 17:20212256-20212278 AGGGCTAAGAACCGAGCAGAGGG + Intronic
1147769625 17:42858551-42858573 TGGGCTTGGGGCAGAACAGAAGG - Intergenic
1151786583 17:76278193-76278215 CAGGGTGTGAGCAGAACAGAGGG + Intronic
1153812829 18:8766800-8766822 TGGGCATAGGGCAGAACAGAGGG - Intronic
1154166080 18:12015448-12015470 CGGGCTCACAGCAGCAGAGATGG - Intronic
1155711004 18:28879158-28879180 CGGTTTCAGAGCAGAACTGAAGG + Intergenic
1156360162 18:36377814-36377836 TGGGCTAAGAGGGGAACAGATGG - Intronic
1156529646 18:37802910-37802932 ATAGCTAAGAGCAGAACTGAAGG - Intergenic
1159632585 18:70766069-70766091 CTAGCTCAGAGCAGAACTGAAGG - Intergenic
1160374950 18:78404733-78404755 AGGGCTAAGAGGTTAACAGAGGG - Intergenic
1161039085 19:2100536-2100558 GGGGCTCAGAGCAGCACAGACGG - Intergenic
1162458162 19:10798305-10798327 GGAGCTAAGAGCAGAAGAGTGGG - Intronic
1166388091 19:42393150-42393172 GGGGCTGGGAGCAGAACAGGAGG + Intergenic
927882370 2:26697764-26697786 TGGGGAAAGAGCGGAACAGAAGG - Intronic
929329342 2:40661188-40661210 GGGGTTAAGAGAAGAAAAGAGGG + Intergenic
930605968 2:53493346-53493368 CAGACTAAGACAAGAACAGATGG + Intergenic
933550212 2:83767199-83767221 CAAGCTCAGAGCAGAACTGAAGG + Intergenic
934574444 2:95391334-95391356 CTGGTCAAGAGCTGAACAGAGGG - Intergenic
934984530 2:98874698-98874720 TGGCCCAAGACCAGAACAGAAGG - Intronic
939674524 2:145055445-145055467 ATGCCTAAGAGCAGAAAAGAAGG - Intergenic
940828133 2:158436620-158436642 CAGGATCAGAGCAGAACGGAAGG + Intronic
947858656 2:233342491-233342513 CCGGCTCAGCGCTGAACAGATGG - Intronic
1169290044 20:4341735-4341757 GGGACTAAGAGCAGAAATGAGGG - Intergenic
1171271490 20:23821898-23821920 GGGGCTGAGAGCAGAACAGCAGG - Intergenic
1172021663 20:31919009-31919031 CATGCTCAGAGGAGAACAGAAGG + Intronic
1173693541 20:44985779-44985801 CAGGCTAAGAGAATAAGAGAAGG + Intronic
1174085737 20:48006128-48006150 CAGGCTAAGAGCAGCAGGGAGGG - Intergenic
1175273806 20:57753878-57753900 CTGCCTGAGAGCAGCACAGAGGG - Intergenic
1175494681 20:59405352-59405374 CTGGCTGAGTGCAGAACAGCAGG + Intergenic
1176783963 21:13232603-13232625 AGGGCTAACAGAAGAGCAGAAGG - Intergenic
1177028460 21:15952181-15952203 CAGGATCAGAGCAGAACTGAAGG - Intergenic
1180270788 22:10585269-10585291 ATAACTAAGAGCAGAACAGAAGG + Intergenic
1183397819 22:37582929-37582951 CAGGGCAAGAGCAGAGCAGAGGG - Intergenic
1183712672 22:39514722-39514744 AGGGACAAGAGCAAAACAGAAGG - Exonic
1184423007 22:44392665-44392687 CGGGCTCAGAGCTCCACAGAAGG - Intergenic
953942557 3:47113266-47113288 TGGGATAAGAGTAGAAGAGAAGG - Intronic
959711657 3:109391742-109391764 CAGGCAAAGAGAAGAACAGGAGG - Intergenic
960072613 3:113448248-113448270 TGGGCTAAGATTAAAACAGATGG - Intronic
961025498 3:123552089-123552111 AGAGAGAAGAGCAGAACAGAAGG + Intronic
963543119 3:146620050-146620072 AGAGCTAAGAGCAAAACTGAAGG - Intergenic
967201832 3:187078831-187078853 CGGGCAGAAAGCAGAACATAAGG + Intergenic
970412390 4:15821333-15821355 CAAGCTCAGAGCAGAACTGAAGG + Intronic
976078148 4:81322287-81322309 CAAGCTCAGAGCAGAACTGAAGG + Intergenic
976527569 4:86112211-86112233 CAAGCTCAGAGCAGAACTGAAGG - Intronic
979628495 4:122873366-122873388 AAGGCTAGGAACAGAACAGAAGG - Intronic
984922030 4:184773547-184773569 CGGACCAAAAGCAGAAGAGAAGG - Intronic
988919082 5:35924309-35924331 CTGGCCAAGACCAAAACAGACGG + Intronic
990443634 5:55871397-55871419 CAGGCTGAGAACAGAAAAGAAGG - Intronic
993020139 5:82582221-82582243 CAAGCTCAGAGCAGAACTGAAGG - Intergenic
995579860 5:113585615-113585637 GGGACAAAGAGCAGAACAGTGGG - Intronic
998873066 5:146572016-146572038 CAGGATCAGAGCAGAACTGAAGG - Intergenic
999218212 5:149954027-149954049 CTGGCTAAGAGCAGAACTGCTGG - Intergenic
1002100918 5:176857141-176857163 CGGACTAAGTGCAGCAGAGAAGG - Intronic
1002959905 6:1904989-1905011 GGGGATAAGGGCAGAAAAGATGG + Intronic
1003028356 6:2578829-2578851 CTGGGCAAGAGCAGAACAGTGGG + Intergenic
1003842094 6:10131687-10131709 GGAGCTAAGAGAAGAAAAGAAGG - Intronic
1005849064 6:29805352-29805374 CGTGGTAAGAGAGGAACAGAGGG - Intergenic
1010070846 6:71743504-71743526 AGGGCTAAGAATAGAACACATGG - Intergenic
1011711300 6:90057116-90057138 CGAGATCAGAGCAGAACTGAAGG + Intronic
1018235042 6:161715848-161715870 CTGGCAAACAGCAGAGCAGAGGG - Intronic
1018626192 6:165781133-165781155 CGAGCAAAGAGAAGACCAGAGGG - Intronic
1019686262 7:2383863-2383885 CGGGCTGATAACAGAGCAGAGGG - Intergenic
1020250109 7:6460703-6460725 CTGGCTAAGAGAAGAGCAGGTGG - Intronic
1022357682 7:29631083-29631105 TGGGCAAGGAGCAGAACAGATGG + Intergenic
1022507157 7:30914424-30914446 CTGGCTAAGAGCAGCCCAGCAGG + Intronic
1025227950 7:57180103-57180125 AGGGCTAAGAGCAGTGCAGGAGG + Intergenic
1026077271 7:67183695-67183717 TGGGCTAAGAGCAGAAAAAATGG - Intronic
1026415919 7:70180575-70180597 CGGCCTAAGAGCAAAGCAAAAGG - Intronic
1026653153 7:72233369-72233391 GGGGCTAAGGGGAGAAGAGAAGG + Intronic
1026699598 7:72628406-72628428 TGGGCTAAGAGCAGAGAAAATGG + Intronic
1028718752 7:94004569-94004591 CGGGCTGCGAGCGGAACAGCGGG - Intergenic
1029633461 7:101768029-101768051 GGGGTTAAGAGTAGAACAGAGGG - Intergenic
1031990264 7:128192833-128192855 GGAGCTGAGAGCAGAGCAGAGGG - Intergenic
1035425051 7:158765080-158765102 CTGGCTCAGAGGAGAACAGATGG + Intronic
1035495026 7:159317079-159317101 CTGAATAATAGCAGAACAGAGGG - Intergenic
1037484317 8:19333079-19333101 CCGGCTGAAAGCAGAACAGGAGG + Exonic
1037681721 8:21103212-21103234 AGTGGTAAGAGCATAACAGATGG + Intergenic
1037704880 8:21310434-21310456 CGGGCTAAGAGTCAATCAGAAGG + Intergenic
1038916942 8:32034943-32034965 CAAGCTCAGAGCAGAACTGAAGG - Intronic
1039906608 8:41791009-41791031 TGGGCTGACAGCAGGACAGAGGG + Intronic
1042318740 8:67452454-67452476 ATGGCTAAGAGCAGAACAATTGG - Intronic
1043028588 8:75103137-75103159 CAGCCTAAAATCAGAACAGAAGG - Intergenic
1043827165 8:84943181-84943203 CTGGGAAACAGCAGAACAGAGGG - Intergenic
1045542990 8:103103938-103103960 CCTCCTTAGAGCAGAACAGAGGG + Intergenic
1048357699 8:133667128-133667150 AGAGCTGAGAGCAGAACAGAGGG - Intergenic
1050166859 9:2773910-2773932 CAGGATCAGAGCAGAACTGAAGG + Intronic
1050393425 9:5170486-5170508 CAAGCTTAGAGCAGAACTGAAGG + Intronic
1050829696 9:9995626-9995648 AGGCCTAAGAGCAAAACAGGAGG - Intronic
1053826533 9:42030581-42030603 TGGGATAAGGGCAGACCAGATGG - Intronic
1054604027 9:67156816-67156838 TGGGATAAGGGCAGACCAGATGG + Intergenic
1056718767 9:89055641-89055663 CGGGCTAAGAGCAGAACAGAAGG - Intronic
1059865311 9:118507674-118507696 CGAGATGAGAGCAGAACTGAAGG + Intergenic
1060213954 9:121727129-121727151 CAGGCCAAGAGCAGGACACAAGG - Intronic
1060735202 9:126062392-126062414 TGTGCTAAGAGCACAAAAGAGGG + Intergenic
1186432941 X:9520401-9520423 GGGGCTGAGAGCTGAAGAGATGG + Intronic
1190977398 X:55419369-55419391 CAAGCTCAGAGCAGAACTGAAGG + Intergenic
1192066117 X:67886940-67886962 TGAGATCAGAGCAGAACAGAAGG - Intergenic
1193217246 X:78878015-78878037 CAAGCTCAGAGCAGAACTGAAGG + Intergenic
1194177508 X:90668457-90668479 CAAGATCAGAGCAGAACAGAAGG + Intergenic
1199450200 X:147970566-147970588 CAGGATCAGAGCAGAACTGAAGG + Intergenic
1200081088 X:153576711-153576733 TGGGCTGAGAGCAGAGCAGGAGG + Intronic
1200524178 Y:4250603-4250625 CAAGATCAGAGCAGAACAGAAGG + Intergenic
1201435940 Y:13958737-13958759 CGGGCTAAGGGATGACCAGATGG + Intergenic