ID: 1056718768

View in Genome Browser
Species Human (GRCh38)
Location 9:89055660-89055682
Sequence CCATGACAGTTCTGTGTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 125}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056718768_1056718776 -1 Left 1056718768 9:89055660-89055682 CCCGTCACACAGAACTGTCATGG 0: 1
1: 0
2: 1
3: 6
4: 125
Right 1056718776 9:89055682-89055704 GGCTTCTCCCAAGCAGGAGGGGG No data
1056718768_1056718780 28 Left 1056718768 9:89055660-89055682 CCCGTCACACAGAACTGTCATGG 0: 1
1: 0
2: 1
3: 6
4: 125
Right 1056718780 9:89055711-89055733 GATGCCATCTTTTGCAAGTTTGG No data
1056718768_1056718774 -3 Left 1056718768 9:89055660-89055682 CCCGTCACACAGAACTGTCATGG 0: 1
1: 0
2: 1
3: 6
4: 125
Right 1056718774 9:89055680-89055702 TGGGCTTCTCCCAAGCAGGAGGG No data
1056718768_1056718772 -7 Left 1056718768 9:89055660-89055682 CCCGTCACACAGAACTGTCATGG 0: 1
1: 0
2: 1
3: 6
4: 125
Right 1056718772 9:89055676-89055698 GTCATGGGCTTCTCCCAAGCAGG No data
1056718768_1056718777 3 Left 1056718768 9:89055660-89055682 CCCGTCACACAGAACTGTCATGG 0: 1
1: 0
2: 1
3: 6
4: 125
Right 1056718777 9:89055686-89055708 TCTCCCAAGCAGGAGGGGGCTGG No data
1056718768_1056718773 -4 Left 1056718768 9:89055660-89055682 CCCGTCACACAGAACTGTCATGG 0: 1
1: 0
2: 1
3: 6
4: 125
Right 1056718773 9:89055679-89055701 ATGGGCTTCTCCCAAGCAGGAGG No data
1056718768_1056718775 -2 Left 1056718768 9:89055660-89055682 CCCGTCACACAGAACTGTCATGG 0: 1
1: 0
2: 1
3: 6
4: 125
Right 1056718775 9:89055681-89055703 GGGCTTCTCCCAAGCAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056718768 Original CRISPR CCATGACAGTTCTGTGTGAC GGG (reversed) Intronic
904694422 1:32320515-32320537 CCATCACCTTGCTGTGTGACTGG - Intronic
905389529 1:37627255-37627277 CCAAGACAGCTGTGTGTGCCTGG - Intronic
910445591 1:87296463-87296485 TTATGACAGCTCTGTGAGACGGG + Intergenic
912051682 1:105537239-105537261 CAATGACAGTTCTTGATGACAGG + Intergenic
912223737 1:107707528-107707550 TCATGATAGTGCTTTGTGACTGG + Intronic
912225200 1:107725274-107725296 TCATGATTGTTCTGTGTGACTGG + Intronic
915993555 1:160541687-160541709 CCATGATAATTCTGTGTGGCTGG + Intronic
919679777 1:200422903-200422925 CCATAACAATTCTATGAGACAGG - Intergenic
920075560 1:203333988-203334010 CCAAGACAGCTCTGTGGAACTGG - Intergenic
921473076 1:215571284-215571306 CCAAGTCAGTTTTCTGTGACTGG + Intronic
922435970 1:225606974-225606996 CCTTCACAGGTCTGTGTGCCTGG - Intronic
924174128 1:241372394-241372416 CCATGACAGTCCTGTGAGGTAGG - Intergenic
924548179 1:245049933-245049955 TCATGACAGCTTTGTGTGAAAGG - Intronic
1063504923 10:6589107-6589129 CCATGACATTCCTGGGTCACTGG - Intergenic
1067850829 10:49752593-49752615 CCATGGCAGTGCTGTGTGGGTGG - Intronic
1068876279 10:62000032-62000054 CCATGAAAGTTCTTTGTCAGAGG + Intronic
1069223098 10:65907973-65907995 TCATGACAATTCTGTGTGGTAGG + Intergenic
1071116046 10:82221756-82221778 CCATGACAGTCCTGAGTCTCAGG - Intronic
1073554023 10:104430218-104430240 CCATGATAGCTCTCTGTGACTGG + Intronic
1078063078 11:8060901-8060923 CCATGACTGTGCTGTGTGGGTGG - Intronic
1079157640 11:17963282-17963304 CCATGGCACTTCTCTGTGGCTGG - Intronic
1083884588 11:65566074-65566096 CCTTGACATTTCTGTGAAACAGG - Intergenic
1086243214 11:84720785-84720807 GCATGACAATCTTGTGTGACTGG - Intronic
1087733962 11:101810809-101810831 ACATGAGTGTTCTGTGAGACAGG - Intronic
1089287072 11:117414437-117414459 ACAGGACTGTTCTGTGTGCCAGG - Intergenic
1089907207 11:122053046-122053068 TCATGACAGTTCTTTGAGATAGG - Intergenic
1092803164 12:12191427-12191449 ACATGAGAGTTCTGTGAAACTGG + Intronic
1092923450 12:13252814-13252836 TCATTACAGTACTGTGGGACAGG - Intergenic
1100779835 12:98012216-98012238 TCATGACAGGTGTGTGTCACTGG + Intergenic
1102165139 12:110800113-110800135 CCATGATAGTTCTGAGTTCCAGG - Intergenic
1105508753 13:21033948-21033970 CCATGTGATTTCTGTGGGACAGG + Intronic
1105829949 13:24155277-24155299 CCGTGACAGATCTCTGTCACTGG - Intronic
1106019265 13:25899289-25899311 CCCTGGCAATTCTGTGTTACAGG + Intronic
1108558159 13:51616542-51616564 TCTTGAGAGTTCTGTGTGATAGG + Intronic
1108593168 13:51928415-51928437 TCATGGCAGTGCTGTGAGACAGG + Intergenic
1110699967 13:78535640-78535662 CCAGGACTATTCTGAGTGACAGG + Intergenic
1114128286 14:19757108-19757130 CTGTGACAGTTCTCTGTGAAAGG - Intronic
1115352017 14:32405828-32405850 TCATCACAGTTCTGCATGACTGG - Intronic
1121889391 14:97574759-97574781 CCATGGCAGTGCTGCCTGACAGG - Intergenic
1123159081 14:106260141-106260163 CACTGACAGCTCTGTGTTACAGG + Intergenic
1123160200 14:106270979-106271001 CACTGACAGCTCTGTGTTACAGG + Intergenic
1123607841 15:22053977-22053999 CTGTGACAGTTCTCTGTGAAGGG - Intergenic
1124916940 15:33985060-33985082 CAAATACAGTTCAGTGTGACAGG - Intronic
1127049143 15:55062157-55062179 TCCTGACAGTCCTGTGAGACTGG - Intergenic
1130573296 15:85068374-85068396 CCATGAATGTGCTGGGTGACTGG - Intronic
1132411484 15:101581452-101581474 CCATGACAGGTGTGTGTATCTGG - Intergenic
1202980075 15_KI270727v1_random:345775-345797 CTGTGACAGTTCTCTGTGAAGGG - Intergenic
1134474760 16:14563395-14563417 CCATGACAGATCTGGCTGGCAGG + Intronic
1137711517 16:50570247-50570269 CAAGGCCAGTGCTGTGTGACAGG - Intronic
1137918221 16:52456037-52456059 AAATGACAGTCCAGTGTGACTGG + Intronic
1139159306 16:64484567-64484589 CTATGACAGTTGTCTGTAACAGG - Intergenic
1142968801 17:3597450-3597472 CCAGGCCAGTACTGTGTGGCGGG - Intergenic
1144287785 17:13795217-13795239 CCATGATATTCCTGTGTTACTGG - Intergenic
1144700415 17:17334366-17334388 CCATGACACTTCAGTGAGAAAGG - Intronic
1145941731 17:28746283-28746305 CCATGCCAGGCATGTGTGACTGG + Intronic
1145991662 17:29082684-29082706 CCAAGCCAGTTATCTGTGACAGG + Intronic
1146462575 17:33057799-33057821 CTATGACTGTTCTATGTGACTGG - Intronic
1146659613 17:34656496-34656518 ACATAACAATTCTGAGTGACAGG - Intergenic
1147339155 17:39743576-39743598 AAATCACAGTCCTGTGTGACTGG + Intronic
1147394453 17:40130876-40130898 CCAGAGCTGTTCTGTGTGACTGG + Intronic
1148694948 17:49553155-49553177 CCATGAGAGTCCTGGGTGCCTGG + Intergenic
1152231575 17:79116653-79116675 CCATGACAGTGAGGTGTGTCGGG + Intronic
1153511139 18:5854084-5854106 CCATGAGAGTTCTGTGTTCTTGG - Intergenic
1153760556 18:8327345-8327367 CCTTGGCAGTTCTGTCTGATGGG - Intronic
1161939097 19:7391512-7391534 CCATGAGACTTCAGGGTGACTGG - Intronic
1165114213 19:33519363-33519385 CCATGAGAGTTCCAGGTGACTGG - Intronic
1166246507 19:41530969-41530991 TTTTGTCAGTTCTGTGTGACTGG - Intergenic
1167089539 19:47334067-47334089 CCATGCCTGTGCTGTGTGCCAGG + Intronic
925670244 2:6303281-6303303 CCATGGAAGCTCTGTGTGGCAGG + Intergenic
925737651 2:6978400-6978422 CCATGTCTTTTCTTTGTGACTGG + Intronic
932888087 2:75565142-75565164 CTAGGACAGTTCTCTGTGAAGGG - Intronic
936059476 2:109285050-109285072 CCAGGACAGGGCTGTGTGGCCGG - Intronic
942702382 2:178728209-178728231 CCATGAGAGATCTGTGTCTCTGG - Exonic
942771578 2:179526966-179526988 TTATAACAGTTCTGAGTGACTGG - Intronic
945856048 2:215071313-215071335 CCATGACAATTCTGTCAGATAGG + Intronic
947540943 2:230977588-230977610 GCATGAGAGGTCTGTGTGAACGG + Intergenic
1172046165 20:32081849-32081871 CCATCACAGATCTGTGGGGCAGG + Intronic
1173220818 20:41131701-41131723 CCATGACAATTCAGTGTGATGGG - Intergenic
1173239940 20:41285848-41285870 CCTTAATAGTTCTGTGTGAAAGG - Intronic
1178252778 21:31020599-31020621 TCATGCCATTTCTGGGTGACAGG - Intergenic
1180016155 21:45085860-45085882 CTATGTCAGTTCTGCGTGAGAGG - Intronic
1183100648 22:35581844-35581866 CCATGACAGCCTTGTGTGAACGG - Intergenic
1183347948 22:37318317-37318339 CCCTGGCAGCTCTGTGTGCCAGG - Intergenic
1184624622 22:45714924-45714946 CCATGACAGTGCTCTGTTGCCGG - Intronic
955259962 3:57378310-57378332 CCATGAGACTACTGTGTGAAGGG + Intronic
955273487 3:57525458-57525480 CCATGAGAGTACTGTGAGATGGG + Intronic
956089987 3:65656307-65656329 CCTTGCCAGTTCAGTGTCACAGG - Intronic
956384634 3:68703567-68703589 GCATGACAGTTCTTTGAGATCGG + Intergenic
956471357 3:69570421-69570443 CCAGGACTGTTCTCTCTGACTGG + Intergenic
960873367 3:122273507-122273529 CCATGCCAGGTCTGTGTGTGTGG - Intronic
963646668 3:147923591-147923613 ACATGAAAGTTCTGTGAGAATGG + Intergenic
964994130 3:162853695-162853717 CTCTGACAGTTTTTTGTGACTGG - Intergenic
967106340 3:186257598-186257620 CCATGACAGATCTGCTTTACAGG + Intronic
967289599 3:187906103-187906125 CCATGACAGTGTTGTGAGGCAGG - Intergenic
969086995 4:4664036-4664058 CAATGACAGTACTGTGTGACAGG + Intergenic
969154544 4:5198839-5198861 CAATGGCAGTTCTTTGTGTCAGG + Intronic
970550837 4:17179357-17179379 CCAAGACAGTGCTGGGGGACTGG - Intergenic
979877072 4:125906070-125906092 CCTTCACAGTTCTATGTGTCAGG + Intergenic
984996112 4:185431823-185431845 CCCTGAAAGCTCTGTGTGAATGG - Intronic
989031561 5:37124441-37124463 CAATGTCAGTTCTGTGTGTGTGG - Intronic
989857155 5:46312004-46312026 CCATGACATTTCTGAGTGCTGGG + Intergenic
991665381 5:68994376-68994398 AAATGAGAGTTCTGTGTGATGGG - Intergenic
997044450 5:130297290-130297312 TGATGACAGGTCTGTGTGTCTGG + Intergenic
998667525 5:144315617-144315639 TCATAATAGTTCTGTGTGACGGG + Intronic
999355400 5:150924707-150924729 GAATGACAGTTCTGTATGGCTGG - Intergenic
999828742 5:155299125-155299147 CCAAGCAAGTTCTGTGTGTCAGG - Intergenic
1001204039 5:169745455-169745477 CCATAACAGTACTGTGTCAGAGG - Intronic
1004073364 6:12322644-12322666 CCATGACAAGTCACTGTGACAGG - Intergenic
1004310398 6:14540302-14540324 TCATGACAGTCCTGTGGGGCAGG - Intergenic
1011757278 6:90513063-90513085 CCATCAAACTACTGTGTGACTGG + Intergenic
1022108155 7:27211377-27211399 CCATGACAATTCTCCATGACAGG - Intergenic
1022702828 7:32777446-32777468 CTATGACAGTTGTGAGTCACGGG - Intergenic
1022907054 7:34867566-34867588 CTATGACAGTTGTGAGTCACGGG - Intronic
1024433716 7:49323667-49323689 CATTGACAGTTCTGGGTGGCTGG - Intergenic
1024987947 7:55212197-55212219 CCATGAAAGTTCTGGGTGGAGGG - Intronic
1027217133 7:76191129-76191151 CCATGACAGGCATCTGTGACCGG - Intergenic
1027818411 7:83010073-83010095 TCATGACAATTCTATGTGATAGG - Intronic
1031799645 7:126225700-126225722 GACTCACAGTTCTGTGTGACTGG - Intergenic
1033429042 7:141271804-141271826 CCATGACAATCCTGTGAGGCAGG + Intronic
1034870303 7:154677673-154677695 CCATCAGATTTCAGTGTGACAGG + Intronic
1037446303 8:18969436-18969458 CCAGAAAAGTTCTGGGTGACAGG + Intronic
1043357794 8:79433966-79433988 CAATGACATTTCTGAGTCACTGG + Intergenic
1044942163 8:97354346-97354368 CCATGCCAGGTCAGTGTGTCTGG - Intergenic
1045738439 8:105322400-105322422 CCAATACACTTCAGTGTGACTGG - Intronic
1047502448 8:125452606-125452628 CCATGGCAGTGCTATGTGAAAGG - Intergenic
1055650110 9:78398709-78398731 CCATCACAATTCTGTGAGTCTGG + Intergenic
1056262436 9:84862383-84862405 CCATGACAGTCCTATAAGACAGG + Intronic
1056718768 9:89055660-89055682 CCATGACAGTTCTGTGTGACGGG - Intronic
1059427383 9:114229651-114229673 CCATGACTGATCTGAGTGTCTGG - Intronic
1061371476 9:130200085-130200107 CCACAACAGGTCTGTGTGGCAGG + Intronic
1187676870 X:21724836-21724858 TCATAACAGTTCTGTGAGATAGG - Intronic
1189260167 X:39672919-39672941 CCATGAAAGTTCTCTGTGCTGGG - Intergenic
1196370980 X:114979497-114979519 CCATGACAATTAAGTGGGACAGG - Intergenic