ID: 1056718770

View in Genome Browser
Species Human (GRCh38)
Location 9:89055661-89055683
Sequence CCCATGACAGTTCTGTGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 148}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056718770_1056718772 -8 Left 1056718770 9:89055661-89055683 CCGTCACACAGAACTGTCATGGG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1056718772 9:89055676-89055698 GTCATGGGCTTCTCCCAAGCAGG No data
1056718770_1056718776 -2 Left 1056718770 9:89055661-89055683 CCGTCACACAGAACTGTCATGGG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1056718776 9:89055682-89055704 GGCTTCTCCCAAGCAGGAGGGGG No data
1056718770_1056718780 27 Left 1056718770 9:89055661-89055683 CCGTCACACAGAACTGTCATGGG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1056718780 9:89055711-89055733 GATGCCATCTTTTGCAAGTTTGG No data
1056718770_1056718774 -4 Left 1056718770 9:89055661-89055683 CCGTCACACAGAACTGTCATGGG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1056718774 9:89055680-89055702 TGGGCTTCTCCCAAGCAGGAGGG No data
1056718770_1056718775 -3 Left 1056718770 9:89055661-89055683 CCGTCACACAGAACTGTCATGGG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1056718775 9:89055681-89055703 GGGCTTCTCCCAAGCAGGAGGGG No data
1056718770_1056718773 -5 Left 1056718770 9:89055661-89055683 CCGTCACACAGAACTGTCATGGG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1056718773 9:89055679-89055701 ATGGGCTTCTCCCAAGCAGGAGG No data
1056718770_1056718777 2 Left 1056718770 9:89055661-89055683 CCGTCACACAGAACTGTCATGGG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1056718777 9:89055686-89055708 TCTCCCAAGCAGGAGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056718770 Original CRISPR CCCATGACAGTTCTGTGTGA CGG (reversed) Intronic
900330005 1:2129365-2129387 ACCGTGACAGTTCTGAGTGCAGG - Intronic
902806785 1:18865888-18865910 CCCAAGAAAGTTCTGGGAGATGG + Intronic
903381115 1:22897425-22897447 CCCACGACAGTTGTGTGACAAGG - Intronic
904143798 1:28373775-28373797 CTCACTACAGTTCTGTGAGATGG + Intronic
905034860 1:34911406-34911428 CCTATGACAATTCTGGGTGCTGG + Intronic
905894555 1:41536790-41536812 CACATGACAGCCCTATGTGATGG + Intronic
906612446 1:47212741-47212763 CCCATGACAGCTCTGCAAGATGG + Intergenic
908532324 1:65045618-65045640 CTCATGACAGTTCTATGAGGAGG - Intergenic
910445590 1:87296462-87296484 CTTATGACAGCTCTGTGAGACGG + Intergenic
911617601 1:100031906-100031928 CCCATGATAGTACTCTTTGAAGG + Intergenic
913489787 1:119368314-119368336 CCCAGAACAGTTCTGTGGGCAGG + Intergenic
915667457 1:157458114-157458136 CCCATGACAGTACTTTCTGCTGG - Intergenic
915921316 1:159977898-159977920 CCCATGGCAGGTCCCTGTGATGG - Intergenic
916743467 1:167666320-167666342 CCCATGACACCTCTGTGACATGG - Intronic
923088776 1:230722383-230722405 CCAATGGCAACTCTGTGTGAGGG - Intergenic
924387190 1:243509882-243509904 CCCCTTACAGTTCTGGGCGATGG - Intronic
1064214235 10:13386214-13386236 CACATGACAGGGCTGTTTGAAGG + Intergenic
1067030670 10:42877320-42877342 CCCATGACAAATCTGTGCCATGG + Intergenic
1067153226 10:43753422-43753444 CCCTAAACAGTCCTGTGTGAGGG + Intergenic
1067352356 10:45487963-45487985 GCCATGAAAGTTCTTTGTAAGGG - Intronic
1067352598 10:45490166-45490188 CCCATGATAGTTGTGTATCAGGG - Intronic
1067829785 10:49604833-49604855 ACCATGAAAGTTCTGAGTGGTGG - Intergenic
1070264141 10:74886310-74886332 GCCATCACAGTTCTGGGAGATGG + Intronic
1070631292 10:78086538-78086560 CCCATGGCAGCCCGGTGTGATGG + Intergenic
1071571403 10:86699427-86699449 CACATGCCAGATCTGTGTGGGGG - Intronic
1072419329 10:95276468-95276490 CCCTTGTCACTTCTGTGTTATGG - Intronic
1074537127 10:114336567-114336589 CCTATGCCAGTTCTCTGGGAAGG - Intronic
1076113026 10:127875137-127875159 CCCCTGAAAGTTCTGAGTGCTGG + Intergenic
1083827026 11:65209801-65209823 CCCATGACTGGTCTAAGTGATGG + Intronic
1087811298 11:102611637-102611659 CCCATCACAGCACTGTGCGAAGG + Intronic
1089323384 11:117641480-117641502 CACATGGCAGCTCTGTGTGCAGG - Intronic
1091829415 12:3538979-3539001 CCCAAGACTGTTCTGTGTCCAGG - Intronic
1095081323 12:38002990-38003012 CCTGTGAAACTTCTGTGTGATGG + Intergenic
1097370694 12:58776343-58776365 TCCATTGCAGTTCTGTGTGTGGG - Intronic
1097805008 12:63955497-63955519 CTCATGCCAGTTCTTTGTAAAGG + Intronic
1098161622 12:67650845-67650867 CCTAAGATGGTTCTGTGTGAGGG + Intronic
1100610607 12:96189192-96189214 CCCATGAGTGGCCTGTGTGAGGG + Intergenic
1100769443 12:97905604-97905626 CCCATGACATTTATGGGTGTTGG - Intergenic
1102691466 12:114764708-114764730 CCCGTGACATCTCTGTTTGAGGG - Intergenic
1111062707 13:83044471-83044493 CGCATTACATTTCTGTGTGATGG + Intergenic
1112659654 13:101492970-101492992 CCCAGAAAAGTTCTGTGTAAAGG - Intronic
1113057904 13:106289314-106289336 CTCAAGACAGTTCTCTGTGGAGG - Intergenic
1115873813 14:37837937-37837959 TCCATGACATTTCTGTGGCATGG - Intronic
1116834043 14:49751013-49751035 CAAAGGACAGTTCTGTGAGAAGG + Intronic
1118256051 14:64206921-64206943 CCCATGACAGTTCTGTGAACCGG + Intronic
1119266071 14:73263932-73263954 CCTCTGACAGGTGTGTGTGACGG + Intronic
1121846210 14:97174353-97174375 CCCAAGGCAGTTCTATGTTAAGG - Intergenic
1123607842 15:22053978-22054000 ACTGTGACAGTTCTCTGTGAAGG - Intergenic
1124681837 15:31738574-31738596 GCCATGACAGTTTTCTGTGGAGG + Intronic
1127879219 15:63141502-63141524 CCCAAGACATCTCTGTGTTAGGG - Exonic
1128861478 15:71077781-71077803 CCCAGGCCTGCTCTGTGTGATGG + Intergenic
1130521633 15:84665950-84665972 CCCACCATAGTTGTGTGTGAAGG + Intergenic
1130540831 15:84819770-84819792 TCCATGACACATCTTTGTGAAGG - Intronic
1130606519 15:85322101-85322123 CACAGGACAGTCCTGTCTGATGG - Intergenic
1202980076 15_KI270727v1_random:345776-345798 ACTGTGACAGTTCTCTGTGAAGG - Intergenic
1134297361 16:12958906-12958928 CCCATGAGAGTTGGGTCTGAGGG + Intronic
1134592367 16:15465018-15465040 CAAATGAAAGATCTGTGTGATGG + Intronic
1136557784 16:31018377-31018399 CCCATGACACACCTGTGTAATGG - Intergenic
1137446834 16:48537049-48537071 CCCATGACAGACCTGGGTCAAGG - Intergenic
1138243214 16:55445802-55445824 CTCATGACAGTCCTGGGTGAGGG - Intronic
1139772553 16:69290760-69290782 CCCCAGAGAGTTGTGTGTGAAGG - Intronic
1141924212 16:87156653-87156675 CCTATGGCAGCTCTGTGTGGGGG - Intronic
1142691499 17:1608711-1608733 CCTCTGGCAGGTCTGTGTGAAGG - Intronic
1143853521 17:9831433-9831455 CCAATGACATTGCAGTGTGATGG + Intronic
1144677162 17:17168988-17169010 CACATGTCACCTCTGTGTGACGG + Intronic
1153760558 18:8327346-8327368 ACCTTGGCAGTTCTGTCTGATGG - Intronic
1153829771 18:8911863-8911885 CTCATGACATTTCTGGGTAAAGG - Intergenic
1153911707 18:9710462-9710484 CCTTTGCCAGTTCTGTGTGTAGG + Intronic
1154400590 18:14033218-14033240 CCCATCTTAGTTCTGTGGGAAGG + Intergenic
1159367821 18:67492357-67492379 CAAATGACAATTGTGTGTGAGGG - Intergenic
1160189166 18:76700901-76700923 CACAAGACAGATCTGTGTGTGGG + Intergenic
1160226134 18:77012468-77012490 CCCCTGACAGTTCGGTGTTCTGG - Intronic
1160926480 19:1549101-1549123 CCCATCACAGTTCTGTGCAGGGG + Intergenic
1161649184 19:5473856-5473878 CCCATGCCAGGTCTGAGTGATGG + Intergenic
1163499338 19:17666570-17666592 CCCATGACTGTCCTGTCTAAAGG - Intronic
1166735556 19:45082120-45082142 CACTGGACAGTTCTGAGTGAAGG - Intronic
1166745892 19:45141733-45141755 CCCACGTCACTCCTGTGTGAAGG + Intronic
1168126085 19:54283955-54283977 GCCATGACTGTTCTGTGGGTTGG - Intergenic
1168402880 19:56096090-56096112 CAGATGACAGTTCTGAGTGTTGG - Intronic
926112682 2:10192998-10193020 CCCAGGGCAGGTCTGTGTGAGGG - Intronic
926500966 2:13651351-13651373 CCCTTGACAGCTGTGTGGGATGG - Intergenic
926859717 2:17296170-17296192 CTCAGGTCAGTGCTGTGTGAGGG + Intergenic
927335646 2:21920728-21920750 ACCTTAACAGTTCTGTGTGATGG - Intergenic
928170842 2:29002170-29002192 CCCATTACACTTCTGTGAAATGG - Intronic
929279646 2:40063989-40064011 CCCATGTTAGTTCTGTGGGGTGG - Intergenic
930453651 2:51577807-51577829 CCTATGACAGTTCTCTCTAATGG - Intergenic
931514010 2:63031192-63031214 CCCATGACATGACTGTGAGAAGG + Intronic
931914460 2:66938207-66938229 CCCCTGTCAGTCCTGTGAGAAGG - Intergenic
932888088 2:75565143-75565165 TCTAGGACAGTTCTCTGTGAAGG - Intronic
933036089 2:77400351-77400373 TCAATGACAGTTCTGAGTGTTGG - Intronic
940732241 2:157405812-157405834 CCCATGCCTGTTCTCTCTGATGG + Intergenic
942337794 2:174909046-174909068 CCAAAGACAGTTTTGTGTGAGGG - Intronic
943405700 2:187481421-187481443 CCCTTGTCACTTCTGTCTGAGGG - Intronic
945447964 2:209960476-209960498 CCCATGACATTTTTCTTTGAAGG - Intronic
948334072 2:237194107-237194129 CCCATGGCAGGTCTCAGTGAGGG + Intergenic
1172053872 20:32140760-32140782 CCCCTGACTGCCCTGTGTGAGGG - Intronic
1173220820 20:41131702-41131724 ACCATGACAATTCAGTGTGATGG - Intergenic
1175821340 20:61910766-61910788 CACATGACAGGTCCTTGTGAAGG - Intronic
1181749200 22:24977051-24977073 CTCATGACAGCTCTCTGAGATGG - Intronic
1182801259 22:33033609-33033631 CCCTTGTGAGTTCTGTGTGCAGG - Intronic
1183833933 22:40436452-40436474 CCCATGGCAATTGTATGTGAAGG + Intronic
950102508 3:10366648-10366670 CCCATGTCTGTTCTGTGTACTGG - Intronic
950527207 3:13531481-13531503 CCCTTGCTACTTCTGTGTGATGG + Intergenic
951014480 3:17715232-17715254 CCCAGGTAAGTTCTGTGTTATGG - Intronic
952874488 3:37932420-37932442 CCCTTGACTGTTCTGTATGTTGG - Intronic
955125828 3:56111095-56111117 CCCCAGAAAGTTATGTGTGAAGG + Intronic
955259960 3:57378309-57378331 ACCATGAGACTACTGTGTGAAGG + Intronic
955273485 3:57525457-57525479 ACCATGAGAGTACTGTGAGATGG + Intronic
956488756 3:69749250-69749272 CCAATGACATATCTGTGTGTTGG - Intronic
958901465 3:99892315-99892337 TTCATGACAGTTCTCAGTGAAGG - Intronic
960438787 3:117661178-117661200 CCCATGACATTTCTAAGTGTGGG + Intergenic
961426544 3:126852784-126852806 CCCATGACAGTGATGTGTTCTGG - Intronic
968118617 3:196108683-196108705 CTCATGGCAGTTCTGTGTCTGGG - Intergenic
971145330 4:23970037-23970059 CCCATAAGCATTCTGTGTGATGG + Intergenic
976091444 4:81461940-81461962 CCCATGACCGTTTTGTGGGTTGG - Intronic
982037066 4:151356161-151356183 CCCACCACACTTCAGTGTGAGGG - Intergenic
983382648 4:167017262-167017284 CCCAGGACGGTTTTGTGTGATGG - Intronic
986876138 5:12112539-12112561 CCCCTCACAGTCCTGTGTAAAGG + Intergenic
988744729 5:34123148-34123170 CCCATGGCAGTTCTCTGAGGTGG - Intronic
989291398 5:39770377-39770399 TCCATCAAGGTTCTGTGTGATGG + Intergenic
989857153 5:46312003-46312025 GCCATGACATTTCTGAGTGCTGG + Intergenic
991622172 5:68556409-68556431 CCCATGACAAGACTGTGTTAAGG - Intergenic
991665382 5:68994377-68994399 AAAATGAGAGTTCTGTGTGATGG - Intergenic
993355580 5:86903160-86903182 TCCATCACAGTTCTGTGTTGGGG - Intergenic
998667524 5:144315616-144315638 CTCATAATAGTTCTGTGTGACGG + Intronic
999240275 5:150123429-150123451 CTCATGACAGTGCTTTGTGGTGG - Intronic
1000811506 5:165868557-165868579 CTCATTACAGTTCTCTGTGATGG + Intergenic
1006030521 6:31173779-31173801 CCCCTGGCAGTGCTCTGTGAAGG - Intronic
1006726252 6:36201155-36201177 CCCATCACTGGTCTGTTTGAAGG - Exonic
1008608985 6:53168470-53168492 CCCATGTCAGTTAAGTGTGAGGG + Intergenic
1011408366 6:87039851-87039873 CTCTTGACAATTCTGTTTGAAGG - Intergenic
1013012423 6:106132612-106132634 TCCATGACAGTTCCTTGGGAGGG - Intergenic
1014621444 6:123672665-123672687 CCTATGATATTTCTGTGTGAGGG + Intergenic
1019340727 7:507631-507653 CTCATGTCAGTTCTGGGTGCTGG - Intronic
1019361610 7:607897-607919 CACATGTCACTTCTGTGTCAAGG - Intronic
1021924194 7:25519186-25519208 CCCATTACATTTCTGGGGGAAGG + Intergenic
1024987949 7:55212198-55212220 GCCATGAAAGTTCTGGGTGGAGG - Intronic
1025854661 7:65266735-65266757 TCCAGGTCAGTTCTGAGTGAAGG + Intergenic
1026382338 7:69812184-69812206 CCCATGACAATACTGTGTTTGGG + Intronic
1031035034 7:116779572-116779594 CAGATGACAGTTAAGTGTGATGG - Intronic
1032650931 7:133877682-133877704 CCAAGTACTGTTCTGTGTGAAGG - Intronic
1033307133 7:140232886-140232908 CCCATCACAGTCATCTGTGAAGG + Intergenic
1035103392 7:156420025-156420047 CCCATGACACTTCTCTGTCCAGG + Intergenic
1036198244 8:6742538-6742560 CCTATGACAGTGCTGTCTAATGG + Intronic
1037763133 8:21755573-21755595 CCAATGTGAGTTCTGTGTCAGGG + Intronic
1038054861 8:23848788-23848810 CCTAGGAACGTTCTGTGTGAGGG + Intronic
1039706185 8:40009954-40009976 CCCATGTCAGTTCTAGGTGCTGG + Intronic
1040360940 8:46663964-46663986 CACATGAAAATTCTGTGTAAAGG - Intergenic
1045604806 8:103760481-103760503 ACCATGGCAGTGCTGGGTGAGGG + Intronic
1046357681 8:113109641-113109663 CCCGTGACAGTTCTGTGTTGTGG + Intronic
1046730346 8:117718729-117718751 CCCAGGACATTTCTGAGTAAAGG - Intergenic
1049398000 8:142410845-142410867 CTCACGACAGTGCTGTGTGTGGG + Intergenic
1055593446 9:77842142-77842164 CTGATGACAGCTCTCTGTGAGGG - Intronic
1056561491 9:87733809-87733831 CCCACGCCTGTGCTGTGTGATGG - Intergenic
1056718770 9:89055661-89055683 CCCATGACAGTTCTGTGTGACGG - Intronic
1057248681 9:93481589-93481611 TCCATGCCAGTTGTTTGTGATGG + Intronic
1062099068 9:134718649-134718671 CCCACGGCCGTTCTGTGTGCAGG + Intronic
1186901684 X:14064203-14064225 CCCATGACCCTTCTGTTTCAAGG + Intergenic
1189260169 X:39672920-39672942 ACCATGAAAGTTCTCTGTGCTGG - Intergenic
1191225973 X:58043599-58043621 CCAGTGAGAATTCTGTGTGAGGG + Intergenic
1191788518 X:64943743-64943765 CCCATCACTGTTCTGTATTAAGG - Intronic
1197571998 X:128161590-128161612 CCCATGAGAGTTATGTTTTAAGG + Intergenic
1197835195 X:130686665-130686687 CCCAAGACATTGCTTTGTGAAGG - Intronic