ID: 1056718774

View in Genome Browser
Species Human (GRCh38)
Location 9:89055680-89055702
Sequence TGGGCTTCTCCCAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056718768_1056718774 -3 Left 1056718768 9:89055660-89055682 CCCGTCACACAGAACTGTCATGG 0: 1
1: 0
2: 1
3: 6
4: 125
Right 1056718774 9:89055680-89055702 TGGGCTTCTCCCAAGCAGGAGGG No data
1056718766_1056718774 25 Left 1056718766 9:89055632-89055654 CCAAATGCACCTTCTGTTCTGCT 0: 1
1: 0
2: 0
3: 15
4: 226
Right 1056718774 9:89055680-89055702 TGGGCTTCTCCCAAGCAGGAGGG No data
1056718770_1056718774 -4 Left 1056718770 9:89055661-89055683 CCGTCACACAGAACTGTCATGGG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1056718774 9:89055680-89055702 TGGGCTTCTCCCAAGCAGGAGGG No data
1056718767_1056718774 16 Left 1056718767 9:89055641-89055663 CCTTCTGTTCTGCTCTTAGCCCG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1056718774 9:89055680-89055702 TGGGCTTCTCCCAAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056718774 Original CRISPR TGGGCTTCTCCCAAGCAGGA GGG Intronic
No off target data available for this crispr