ID: 1056719705

View in Genome Browser
Species Human (GRCh38)
Location 9:89061149-89061171
Sequence GAGGTGAATTTTCTGATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056719705_1056719711 16 Left 1056719705 9:89061149-89061171 CCAACCATCAGAAAATTCACCTC 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1056719711 9:89061188-89061210 CGATGGCATATTTAACCACCTGG No data
1056719705_1056719709 -1 Left 1056719705 9:89061149-89061171 CCAACCATCAGAAAATTCACCTC 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1056719709 9:89061171-89061193 CCTGCCACAGTGTCATTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056719705 Original CRISPR GAGGTGAATTTTCTGATGGT TGG (reversed) Intronic
903457378 1:23497082-23497104 GAGGTGAATTTACTTATGTGAGG - Intergenic
904941810 1:34168925-34168947 GAGATGACTTTTCAGATGGAGGG + Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
910668123 1:89745989-89746011 GTGGAGAATATTCTGATTGTCGG - Intronic
910772000 1:90840121-90840143 GAGGTCTGTTTTCTGATGTTGGG + Intergenic
912370981 1:109173835-109173857 CAGGTGATGTTTCTGAGGGTGGG + Exonic
915222046 1:154382694-154382716 GAAGTGAATTTTCTGGTCATAGG - Intergenic
916204819 1:162306262-162306284 GCAGTGAAGTTTCTGATGCTGGG + Intronic
916334102 1:163650608-163650630 GAGGAGAATTTTCTGTTCATGGG - Intergenic
919992461 1:202717983-202718005 GAGGTGGCTTTGCTGATGGTGGG + Intergenic
920989654 1:210924810-210924832 GATGTGGATTTTCTGGGGGTTGG - Intronic
923666060 1:235999701-235999723 GGGGTGACTTTTCTCAAGGTGGG + Intronic
1068002795 10:51356057-51356079 AAGGTGAATTCTATGATGGGAGG - Intronic
1068507325 10:57917780-57917802 GAGGTGAATTGCCTGAGGCTGGG - Intergenic
1072845492 10:98825752-98825774 GAGATAAATTTTCTCATAGTAGG - Intronic
1074289792 10:112129878-112129900 AATATGAATTTTCTGAGGGTAGG - Intergenic
1075884155 10:125882832-125882854 GAGTGGAATTTTCTGATTCTTGG - Intronic
1075972628 10:126667564-126667586 GTGGAGACCTTTCTGATGGTAGG - Intronic
1076658774 10:132041533-132041555 GAGGTGCATCTTCTGGTGTTGGG + Intergenic
1078013416 11:7591918-7591940 GAGGTGCCTTTTCTCATGGAGGG + Intronic
1078944432 11:16047612-16047634 GAGGGCAATTTTTTGATGATAGG + Intronic
1080026531 11:27620996-27621018 TAGTGTAATTTTCTGATGGTAGG - Intergenic
1081077930 11:38698468-38698490 GAGGTGAAGATTCTGATTTTGGG - Intergenic
1081726743 11:45335198-45335220 GGGGTGGATTTCCTGATGGAGGG + Intergenic
1083059549 11:59855593-59855615 AAGGTGTATTTTCTGACTGTTGG - Intronic
1083990870 11:66244977-66244999 GAGGTGGATTTGGGGATGGTGGG - Intergenic
1089140723 11:116281818-116281840 GAGCTGACTTTTCTGATTGGGGG - Intergenic
1089907741 11:122061147-122061169 AATGTGGATTTTCTGATTGTTGG - Intergenic
1090949267 11:131458465-131458487 CAGATGAATTTTGTGATGGTGGG - Intronic
1093165769 12:15803380-15803402 TTGGTGAATTTACTGATTGTGGG - Intronic
1094029854 12:25999111-25999133 TAGGTGAGTCTTCTGATGGAGGG + Intronic
1094663681 12:32497023-32497045 TGGGTGAGTTTTTTGATGGTTGG + Intronic
1097822940 12:64145891-64145913 GAGGGGAGCTTTTTGATGGTGGG + Exonic
1101336433 12:103801126-103801148 AGGGTGAATTTTATGATGTTTGG - Intronic
1104281084 12:127378308-127378330 GAGGTGAATTTTATGGTGTATGG + Intergenic
1109581310 13:64340043-64340065 GAGGTGTTTGTTCAGATGGTTGG + Intergenic
1111788247 13:92818514-92818536 GAGATGAATAATCTGATTGTTGG + Intronic
1113996768 14:16090481-16090503 GAGGTGAACTTTCTTTTGATTGG - Intergenic
1114740228 14:25089201-25089223 GAGGTGGCTCTTCTGAAGGTGGG + Intergenic
1119290911 14:73494178-73494200 CAAGTGAATATTCTCATGGTTGG + Intronic
1120280610 14:82433069-82433091 TAGGAGAATTTGGTGATGGTTGG - Intergenic
1121990352 14:98551304-98551326 GAGGAGTATTTTATTATGGTTGG + Intergenic
1122359065 14:101147899-101147921 TAGGGGCATTTTCTGTTGGTTGG + Intergenic
1125215566 15:37269575-37269597 GATGTGGACTTTGTGATGGTAGG - Intergenic
1131145250 15:90006934-90006956 GGGGTGACTTCTCTGATGTTTGG + Intronic
1131593409 15:93773085-93773107 GAGGTGACATTTCAGAAGGTCGG + Intergenic
1131729406 15:95263473-95263495 GAGCAGAATTTTCTGATACTGGG + Intergenic
1135204467 16:20471314-20471336 GAGATGAATGTTCAGAAGGTGGG - Intronic
1135214420 16:20552497-20552519 GAGATGAATGTTCGGAAGGTGGG + Intronic
1137659655 16:50193656-50193678 GAGGAGGTTTGTCTGATGGTTGG + Intronic
1137900421 16:52261781-52261803 ACTGTGTATTTTCTGATGGTGGG + Intergenic
1139086289 16:63590482-63590504 GTGGTGAATATTCTCATGTTGGG + Intergenic
1142589136 17:993709-993731 GAGGTGGATTATGTGAGGGTGGG - Intergenic
1142589177 17:993943-993965 GAGGTGGATTATGTGAGGGTGGG - Intergenic
1152185537 17:78854446-78854468 AAGGTGAATTCTCAGATGATAGG - Exonic
1157118296 18:44883055-44883077 GTGGTGAAGTTACTGATGTTGGG - Intronic
1158354636 18:56604088-56604110 GAAGTGAGTTTTCTTAGGGTGGG - Intronic
1159428890 18:68325374-68325396 GAGCTGAATTCTTTGCTGGTGGG - Intergenic
1162845288 19:13387603-13387625 GAGGTCAATTCTCTGCTGGTTGG + Intronic
1163233536 19:16018872-16018894 GAGGTGAGTTTGGTGATGGTCGG - Intergenic
1164321997 19:24157085-24157107 GAGGTGGTTTTTCACATGGTGGG - Intergenic
926606285 2:14901977-14901999 GTGGTGCATTTTCTGGTGGGAGG - Intergenic
927979799 2:27367900-27367922 GAGGAAAATGTTCTGAGGGTAGG + Intronic
933663526 2:84946340-84946362 AGGGAGATTTTTCTGATGGTAGG - Intergenic
935469337 2:103438188-103438210 GAGGTGACTATTCTGAGGATGGG - Intergenic
935930665 2:108120809-108120831 GAGGTGAAATTTCAGATCTTAGG - Intergenic
936491377 2:112975435-112975457 AAGGTGATTTTTTTTATGGTTGG + Intronic
936915427 2:117635012-117635034 GTGGTGAATGTTCGGCTGGTAGG - Intergenic
937083406 2:119156308-119156330 GAGGTGAATTTTCTGTTTGCTGG + Exonic
937150017 2:119679926-119679948 GAGGACAAATTTCTGCTGGTTGG - Intronic
937459852 2:122076251-122076273 GTGGTGAAATTCCTGTTGGTTGG + Intergenic
938198608 2:129354752-129354774 GAGATGAATGTTCTGGTGGAGGG - Intergenic
942944966 2:181662011-181662033 GAGGTCAATTTTGGAATGGTTGG - Intronic
943015399 2:182503794-182503816 GAAGTGTATATTTTGATGGTGGG - Intronic
943041479 2:182810486-182810508 GAGGTGAAGAATCTGATGTTAGG - Intergenic
943747090 2:191473385-191473407 GAGGTGAGGTGGCTGATGGTTGG - Intergenic
945181537 2:207096707-207096729 GATGTGAATTTTGTGAGGGCAGG + Intronic
947394968 2:229677300-229677322 GAAGTGAAGTGTCTGATGTTGGG - Intronic
947927438 2:233933954-233933976 GAGGTGAGTTTGCTGCTGGAGGG + Intronic
948081619 2:235210147-235210169 GAGGGGATTCTTCTGAAGGTAGG - Intergenic
1172272276 20:33661380-33661402 GAGATGAAGTCTCTGATGGATGG - Intronic
1172478776 20:35258766-35258788 CAGGTGAATTGTATAATGGTTGG - Intronic
1172910084 20:38402093-38402115 GAGGTATATTTTCTGATTGCGGG + Intergenic
1178938468 21:36884541-36884563 GAGCTGAATCTGCTGAGGGTTGG - Intronic
1180310155 22:11216795-11216817 GAGGTGAACTTTCTTTTGATTGG + Intergenic
1181065662 22:20304723-20304745 GAGGTGGGTTTTGTGGTGGTTGG + Intergenic
1185107157 22:48879751-48879773 AACGTGCATTTTCTGATTGTTGG + Intergenic
951790150 3:26472573-26472595 GAATTGAATTTTCTGCTGGAGGG + Intergenic
952985704 3:38779962-38779984 GAGGTGCATTTTCTATTGTTAGG + Intronic
953941073 3:47097883-47097905 GAGGTGGCTTTTCTGATTGAAGG - Intronic
954384332 3:50236432-50236454 GAGGTGAAGTTGCTGCTGTTGGG + Exonic
954546081 3:51436140-51436162 GGGGTGAATTTTCTGGTAGATGG - Intronic
954998054 3:54900132-54900154 GAGGAGAATTTCTTGATGGTAGG + Intronic
958078041 3:88709608-88709630 GACGTGAATATTCTTATGATAGG - Intergenic
958427480 3:93995875-93995897 AAGGTGACTCTTTTGATGGTGGG + Exonic
960673025 3:120170228-120170250 AAGGTGATTTTTCTGATAGTTGG + Intronic
963237297 3:142968185-142968207 TAGGTGAATTTGCTGAGGGAGGG - Intronic
965082398 3:164051304-164051326 GATGTCAATTTTATGATGATTGG - Intergenic
965233326 3:166082329-166082351 GAGGTGAATATTGGGAAGGTTGG + Intergenic
965896053 3:173577588-173577610 GTCATGAATTTTATGATGGTTGG + Intronic
969967686 4:11014051-11014073 GAGTTGAAATTTCTGATTTTGGG + Intergenic
970319284 4:14859981-14860003 GAGCTGCATTTTCTAAGGGTGGG - Intergenic
971525113 4:27607022-27607044 GAGTTGCATTTGCTGAAGGTTGG - Intergenic
971735141 4:30439549-30439571 GAGGTGAATTCTCAAATGATAGG + Intergenic
975111125 4:70627543-70627565 GAGATGAATTTGCAAATGGTAGG - Intergenic
977296342 4:95213603-95213625 GATGTGAATTGTCTGAAGGGAGG - Intronic
977559971 4:98522338-98522360 GAAGTGAATTTTCTCCTGGTGGG + Intronic
980133769 4:128841265-128841287 GAGGTGAATTATCAGAAAGTTGG + Intronic
980764634 4:137285781-137285803 GAGATGAATGTGCTAATGGTTGG - Intergenic
981504488 4:145483723-145483745 GAGATGATTTTTCTGGAGGTGGG + Intronic
982301518 4:153883447-153883469 GAGGAGAGTTTTATGATGTTAGG + Intergenic
982602486 4:157469615-157469637 GAATTGCATTATCTGATGGTTGG - Intergenic
987421123 5:17720883-17720905 GTGGTGAATTTTTTGAGGGAAGG + Intergenic
989404010 5:41040225-41040247 GAGGTTAAATTTCTGAAAGTTGG + Intronic
989552623 5:42753664-42753686 GCTTTGAATTTACTGATGGTTGG - Intergenic
990502947 5:56415093-56415115 GAGGTGAAGTTTCTCATGCATGG - Intergenic
992105004 5:73443208-73443230 GAGGTGGTTATTCTGATGGAAGG - Intergenic
993679459 5:90858135-90858157 TAGTTTAATTTTCTGATAGTTGG - Intronic
993782112 5:92079416-92079438 CAGGTCACTTTCCTGATGGTCGG - Intergenic
994468735 5:100174698-100174720 CAGGTGGATTTTCTGTTGTTTGG - Intergenic
996210594 5:120804485-120804507 GAATTGAATTTGTTGATGGTTGG - Intergenic
996891438 5:128425859-128425881 GAGTTGAATTTTCTCATTATTGG + Intronic
998299822 5:141007176-141007198 CAGGAGAATGTTTTGATGGTGGG + Intronic
1000292459 5:159883203-159883225 GAGGTGGGTTTTTTGATTGTAGG - Intergenic
1000481348 5:161779181-161779203 GAGGTGTATTTTCTGTTATTAGG - Intergenic
1003440826 6:6139956-6139978 AAGGTGAATTAATTGATGGTTGG + Intergenic
1008106579 6:47445519-47445541 GTGGTGAAATTTCTGGTGTTGGG + Intergenic
1009460850 6:63911236-63911258 GAGGTCAACTTCCTGCTGGTTGG + Intronic
1011375688 6:86683674-86683696 GAGGGGTATCTTCTGATGGCAGG + Intergenic
1012791463 6:103703156-103703178 CAGGTGAATTTTATGATTTTTGG - Intergenic
1012908402 6:105093238-105093260 GAGGTAAATTTTCTCATGACAGG + Intergenic
1014062029 6:117082722-117082744 GAGGTAAAAATTCTGATGGGTGG - Intergenic
1014127626 6:117794892-117794914 GGGGTGCATTTTTTCATGGTGGG + Intergenic
1020865811 7:13560945-13560967 GAGGTAAATGTTCTCATGTTGGG + Intergenic
1022389464 7:29930700-29930722 TTGGTGACTTTTCTGAAGGTTGG - Intronic
1028505211 7:91562870-91562892 AAATTGAATTTTCTGATCGTAGG + Intergenic
1030339173 7:108357751-108357773 GAGGTGCATTTACTGAAGATAGG - Intronic
1030759287 7:113331459-113331481 GAGTGGGATTTTCTGATCGTGGG - Intergenic
1031389438 7:121195589-121195611 GAGGTGAATTTAGTAATGATTGG - Intronic
1031638245 7:124128571-124128593 GAGGAGAAAATTGTGATGGTTGG + Intergenic
1031643997 7:124201315-124201337 GAAGTGGATTTTCTGATATTAGG + Intergenic
1032205937 7:129865467-129865489 CAGGTGAAATTTCTGGTGATTGG - Intronic
1032659925 7:133971556-133971578 GAGGTGAATTTTCTTAAGGCAGG + Intronic
1032732859 7:134661231-134661253 GACTTAAATTTTCTGATGTTTGG - Intronic
1033734575 7:144208952-144208974 GAGGTGTCCTTTCAGATGGTTGG + Intergenic
1033748477 7:144342017-144342039 GAGGTGTCCTTTCAGATGGTTGG - Intergenic
1034406963 7:150910940-150910962 GTGTTGAATTTTCTGATGAGTGG - Intergenic
1036344533 8:7950709-7950731 GATGTGTCTTTTCTGATGATAGG - Exonic
1038453053 8:27652095-27652117 GAGGTGAAATTGCTGCAGGTAGG - Intronic
1041160358 8:55035731-55035753 GAGTTCAATTCTCTGATGTTTGG - Intergenic
1043035412 8:75191761-75191783 GAAGAGAATTTTCTGGTGGTAGG + Intergenic
1043162120 8:76858607-76858629 TAGGTTAATTTACTTATGGTGGG + Intronic
1043381100 8:79703076-79703098 GAAGTGAATTCACTGTTGGTTGG - Intergenic
1044173078 8:89081314-89081336 GAGGTAAATTTTCAGATGCAGGG + Intergenic
1044308284 8:90663671-90663693 GAGGTGACTATTCTTATGTTAGG - Intronic
1044336450 8:90989339-90989361 GAGGTGTATTTTCAGACAGTGGG + Intergenic
1049227622 8:141465179-141465201 GAGGTGTATTTTCTGTTGTCAGG - Intergenic
1049852848 8:144843140-144843162 CATGTGAATTTTTTGATGCTGGG - Exonic
1056719705 9:89061149-89061171 GAGGTGAATTTTCTGATGGTTGG - Intronic
1058957152 9:109959793-109959815 GAGGGAAATTTTCTCCTGGTAGG - Intronic
1060472568 9:123960766-123960788 GAAGTGTAGTTTCTGATGGGTGG + Intergenic
1188594269 X:31878253-31878275 GAGGTAAATGTTATGATGGTGGG - Intronic
1189716463 X:43871535-43871557 CAGGTGAATGTTCTGAGGGGTGG - Intronic
1189786282 X:44561413-44561435 CAGGTGAATTTCCTGAGGTTAGG + Intergenic
1190092195 X:47448972-47448994 AGGATGAATTTTCTGATGGTGGG + Exonic
1191021296 X:55863309-55863331 TAGGTGAGTCTTCTGATGGAGGG - Intergenic
1191810702 X:65184492-65184514 AAGGTGGATTTTGTGATGGATGG + Intergenic
1197882354 X:131180260-131180282 GAAGTGAATTATCTGATGCTTGG + Intergenic
1197927275 X:131659965-131659987 GAGTTGAATTTTCTGGTCCTTGG - Intergenic
1198701738 X:139404357-139404379 GTGGTGGATTTTCTGATAGAAGG - Intergenic
1202177294 Y:22109617-22109639 GAGTGGAATGTTCTGATGTTGGG - Intergenic
1202214067 Y:22476767-22476789 GAGTGGAATGTTCTGATGTTGGG + Intergenic