ID: 1056721032

View in Genome Browser
Species Human (GRCh38)
Location 9:89072210-89072232
Sequence CACATTTGTGTCTTTCCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 6, 1: 6, 2: 12, 3: 42, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056721032_1056721036 19 Left 1056721032 9:89072210-89072232 CCTTGTGGAAAGACACAAATGTG 0: 6
1: 6
2: 12
3: 42
4: 276
Right 1056721036 9:89072252-89072274 GACCTTGAGCTGCTTATGACAGG No data
1056721032_1056721039 23 Left 1056721032 9:89072210-89072232 CCTTGTGGAAAGACACAAATGTG 0: 6
1: 6
2: 12
3: 42
4: 276
Right 1056721039 9:89072256-89072278 TTGAGCTGCTTATGACAGGGAGG No data
1056721032_1056721037 20 Left 1056721032 9:89072210-89072232 CCTTGTGGAAAGACACAAATGTG 0: 6
1: 6
2: 12
3: 42
4: 276
Right 1056721037 9:89072253-89072275 ACCTTGAGCTGCTTATGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056721032 Original CRISPR CACATTTGTGTCTTTCCACA AGG (reversed) Intronic
900078867 1:840342-840364 CACATTTTTGTCATTCCCTAAGG - Intergenic
900320693 1:2082101-2082123 CGCCTAAGTGTCTTTCCACACGG + Intronic
902234118 1:15046894-15046916 GACATATCTGTCTGTCCACAAGG - Intronic
902573126 1:17359571-17359593 CACGTTGGTGTCTTTCCACAAGG + Intronic
904312899 1:29640726-29640748 CATATTTGTGTGTCTCCCCAGGG + Intergenic
906254601 1:44338459-44338481 CACACATGTGCCTCTCCACAGGG + Intronic
906647489 1:47485984-47486006 CACATCTGTGTCATGCCTCAGGG - Intergenic
907675358 1:56512893-56512915 CACATTTGTGTATTTCCCTGGGG + Intronic
908540776 1:65120135-65120157 TGCATTTGTGTCAATCCACAAGG + Intergenic
908878244 1:68701802-68701824 CACATTTGAGCCTTTGCAAAAGG + Intergenic
909267945 1:73586332-73586354 CACAATTTTGTCCTTCCAGAGGG + Intergenic
911010500 1:93275935-93275957 TACATTTGTTTCTTTACACATGG + Intronic
911293473 1:96085084-96085106 TACATTTGTGTGTTTCCTCTTGG + Intergenic
911622103 1:100076555-100076577 CACTTTTGTCTCTTTGCAAATGG - Intronic
912068317 1:105775905-105775927 CTCATTTGTGTCTTTACAGCAGG - Intergenic
912197949 1:107422314-107422336 CTCCTTTGTTTCTTTCCATATGG - Intronic
912943484 1:114065971-114065993 AACATTTGGGTCTCTCCACCAGG - Intergenic
912978717 1:114351891-114351913 ACCATTAGTGTCTTTCCACAAGG - Intergenic
915387569 1:155509843-155509865 CAAATTTATCTCTTTCCAAATGG - Intronic
916118676 1:161509802-161509824 CATATTTGTGTCTTTCAGAATGG + Exonic
918837592 1:189487880-189487902 CATGTTTCAGTCTTTCCACAAGG + Intergenic
919309105 1:195884099-195884121 CACAGTTGTTTCCTTCCACAGGG + Intergenic
920786280 1:209044881-209044903 GACATTTTTTTCTTTCCACGTGG - Intergenic
920920829 1:210295983-210296005 CTCATTTCTGTCTTTCCAAAGGG - Intergenic
921566291 1:216724522-216724544 CACATTTGTTTCTATACATAAGG + Intronic
922899333 1:229123917-229123939 CACCTGTGTGTCCTTACACATGG - Intergenic
922995020 1:229949807-229949829 CAATTTTGTGTATTTCCATATGG - Intergenic
923424144 1:233851915-233851937 CAAATTTGTGGTTTTCAACATGG + Intergenic
923841473 1:237676404-237676426 CACATTTCATTCTATCCACAGGG + Intronic
924564149 1:245182181-245182203 AACATTTCTGTCACTCCACAAGG + Intronic
1063121098 10:3106241-3106263 CACCTGTGTGTCCTTCCCCATGG + Intronic
1063121115 10:3106306-3106328 CACCTGTGTGTCCTTCCCCATGG + Intronic
1063121132 10:3106371-3106393 CACCTGTGTGTCCTTCCCCATGG + Intronic
1063121149 10:3106436-3106458 CACCTGTGTGTCCTTCCCCATGG + Intronic
1063555734 10:7077753-7077775 CACCTTTGCTTCTTTCCTCAAGG - Intergenic
1064918096 10:20484813-20484835 CACATTTGTGTCTTTCCACAAGG - Intergenic
1065324358 10:24537660-24537682 CACATTTGTATGTTTCCATGAGG - Intronic
1065900463 10:30202646-30202668 TACATTTGTTTCTTTCTAAATGG + Intergenic
1067141060 10:43657376-43657398 CACATTTATGTAATTCCAGAGGG + Intergenic
1067670081 10:48312010-48312032 CACATTTATGTCCTAACACAAGG + Intronic
1069198073 10:65579619-65579641 TACACTTTTATCTTTCCACATGG - Intergenic
1070316730 10:75320720-75320742 CACATATGTTTTTTTCCTCAGGG + Intergenic
1070385867 10:75923889-75923911 CACTTTGGTGTGTTTCCACTTGG - Intronic
1071161769 10:82755009-82755031 GTCATTTGTTTCTTTTCACAAGG - Intronic
1071343785 10:84672222-84672244 CACATCTGTGCTTTTGCACATGG + Intergenic
1071703075 10:87963572-87963594 CACACTAGTGTCTTTACACTTGG - Intronic
1071740114 10:88348424-88348446 CACATTTAGGCCTATCCACAAGG + Intronic
1072462804 10:95635641-95635663 CACACCTGTGTCTTCCCCCAAGG - Intronic
1073629321 10:105132549-105132571 CAGATTTCTGTCTTTCCTCCAGG + Intronic
1073932178 10:108588532-108588554 CACAGTTGTGTCCTTATACATGG + Intergenic
1075264047 10:120985813-120985835 CACATTTGTGTCTCTCAAGCTGG - Intergenic
1075907271 10:126092539-126092561 AACATGTGTGTCTCTCCAAAAGG - Intronic
1075923002 10:126228660-126228682 CACATTTTTGTCCTTCCTCCTGG + Intronic
1075926107 10:126252911-126252933 CACCTTTGTCCCTTTCTACAAGG - Intronic
1076364826 10:129914999-129915021 CACATTTGTGTCTTGGCTCAGGG - Intronic
1077663318 11:4088066-4088088 GATATTTTTGTCTTTTCACAAGG + Intronic
1077770117 11:5208313-5208335 CCTATTTGTGTCTTGCAACATGG - Intergenic
1078925141 11:15868039-15868061 CATGTTTGTGTCTTTTCATAAGG + Intergenic
1079630529 11:22668382-22668404 CACATTGGAGACTTTGCACAGGG + Intronic
1081184743 11:40028589-40028611 CAGCTTTGTGTCCTTGCACAGGG - Intergenic
1082722754 11:56698538-56698560 CCCACTTGAGTCTTTCCACATGG - Intergenic
1082963945 11:58946790-58946812 CACTTTTAATTCTTTCCACAAGG + Intronic
1084624656 11:70296799-70296821 CACATTTGTTTCTTTGCTTATGG + Intronic
1087488539 11:98791164-98791186 TTCATTTGTGTTTTTCCAGATGG - Intergenic
1087846241 11:102976841-102976863 CACGTTTGTGTGTTTTCACAAGG - Intergenic
1089027185 11:115283468-115283490 CACCTCTGTGGCTTTACACAGGG - Intronic
1089758754 11:120707424-120707446 CACATTTGTGTGTCTACACATGG + Intronic
1089812419 11:121142884-121142906 CCCTTCTGTGTCTTTCTACAGGG + Intronic
1090800938 11:130171618-130171640 CACGTTTGTGTCTTTCCACAAGG + Intronic
1090801848 11:130177931-130177953 CACCTTTGTGTCTTTCCACAAGG + Intronic
1090873849 11:130771551-130771573 CACCTTCTAGTCTTTCCACAGGG - Intergenic
1090975844 11:131679258-131679280 CCCTTCTGTGTCTTTGCACATGG - Intronic
1098299896 12:69043354-69043376 CACATTTGTTGCTTTCCTCTGGG + Intergenic
1100787895 12:98097946-98097968 CATATTTCTTTCTTTCCAAAAGG + Intergenic
1101426926 12:104595655-104595677 CAGCTCTGTGGCTTTCCACATGG + Intronic
1101627112 12:106455815-106455837 GACATTTGTGTCTTTAAGCAAGG - Intronic
1104146867 12:126042735-126042757 CACATGTATGACTTTCCTCATGG - Intergenic
1104164007 12:126208394-126208416 CTCATTTCTGCCTTTGCACAGGG - Intergenic
1104224470 12:126818303-126818325 CACATATGTGCATTTACACAGGG - Intergenic
1105625329 13:22107085-22107107 CACGTTCGTGTCTTTCCACAAGG - Intergenic
1106375674 13:29184773-29184795 CAGATTTTTGTCATTCCCCAAGG - Intronic
1106859849 13:33894045-33894067 CACACTTTTGTCTTTCCAAGTGG - Intronic
1107989899 13:45810516-45810538 CACATTTTTCTATTTCCAGAGGG - Intronic
1108766152 13:53631763-53631785 TCCATGTGGGTCTTTCCACAAGG + Intergenic
1108790936 13:53968705-53968727 CACATTTATTTCTCTCCCCAAGG - Intergenic
1109640114 13:65180542-65180564 CACATTTGTGACTCCCCATATGG + Intergenic
1109644723 13:65238167-65238189 TACATTTATGTATTTACACATGG + Intergenic
1110439682 13:75513727-75513749 CCCATTAGTCTCTTTCCAAATGG - Intergenic
1112226046 13:97541497-97541519 CACAGGTGTGTCTCTCCATAGGG + Intergenic
1112228339 13:97563275-97563297 CACATTTTTGATTTTACACATGG - Intergenic
1113100215 13:106709593-106709615 CACATTTCTGTCTTGCTACAGGG + Intergenic
1113502138 13:110784263-110784285 CACATTTGGGATTTTCCACCAGG - Intergenic
1113830936 13:113295503-113295525 CACGTTTATGTCTTTCCACAGGG + Intergenic
1114732376 14:25007124-25007146 CACATATGTATCTTCCCAAAGGG - Intronic
1114861215 14:26525379-26525401 AACATTTGTGTCTTAACATAAGG - Intronic
1114888883 14:26890643-26890665 CACATTTGTGTTTTGTCTCAGGG + Intergenic
1115346431 14:32348002-32348024 GACATTTGTGTGTAGCCACATGG + Intronic
1119692691 14:76689775-76689797 CACATCTGTGTCTTCCCAGATGG + Intergenic
1119872222 14:78027708-78027730 CACATTCCTCTCTTTCCAGAGGG + Intergenic
1120243145 14:81973488-81973510 AAGATCTGTGTCTTTCCACATGG + Intergenic
1120288531 14:82536659-82536681 CACATTTGTTTCATTCCTTATGG + Intergenic
1121103995 14:91269163-91269185 CACACGTGTGTCTTTCCACAAGG - Intergenic
1121369014 14:93340023-93340045 CACTTTTGTGTCTTTCTACAAGG - Intronic
1122477007 14:102017292-102017314 CAGGTTTGTTTCTATCCACAAGG + Exonic
1122764527 14:104056680-104056702 CAAATTTGTTTCTTTCAAAATGG + Intergenic
1123027898 14:105437158-105437180 CACAGGTGTGACTTTGCACATGG + Intronic
1123874556 15:24610666-24610688 AACATTTGTGTCTTTCCACAAGG - Intergenic
1125033776 15:35099725-35099747 TACACCTGTCTCTTTCCACATGG + Intergenic
1125415703 15:39450217-39450239 CAAATCTATTTCTTTCCACATGG - Intergenic
1127340742 15:58041100-58041122 CAAATGTGTTTCTTTCCAAAGGG + Intronic
1128504949 15:68261633-68261655 CAGTTTGGTGGCTTTCCACAAGG + Intergenic
1128610950 15:69072979-69073001 CCCATGTGGGTCTCTCCACAAGG - Intergenic
1128865265 15:71110365-71110387 CAGATCTGTGTTTTTCCAAAGGG - Exonic
1131591133 15:93749370-93749392 CACATTCTTCTCATTCCACATGG + Intergenic
1131808724 15:96150389-96150411 CACTTTTGTGTCTCACCACTCGG + Intergenic
1135684418 16:24486908-24486930 CACATTTGTGTCTTTCCACAAGG + Intergenic
1135872805 16:26166432-26166454 CACCTTTGTGTTATTCCACTGGG - Intergenic
1137818052 16:51418290-51418312 CAGATTGGTTCCTTTCCACATGG - Intergenic
1137853366 16:51768359-51768381 CACATTTGTTCCTTTACATATGG - Intergenic
1140616973 16:76676810-76676832 AACATCTGTTTCTTTCCACAAGG - Intergenic
1142870760 17:2818988-2819010 TGCATGTGTGTCTGTCCACATGG + Intronic
1144101142 17:11943333-11943355 CACATATGAGTTTTTTCACATGG + Intronic
1146660396 17:34661670-34661692 CACATTTTTGTTTTTGCACTGGG - Intergenic
1146983633 17:37190631-37190653 CTCTTTAGTGTTTTTCCACAGGG - Intronic
1148530068 17:48381386-48381408 CACCTCTGTGTCTTAGCACATGG + Intronic
1153718006 18:7870218-7870240 AACATTTATGTTTTTCAACATGG - Intronic
1155810248 18:30224247-30224269 CACCTTTGTAACTTTCCAAATGG - Intergenic
1156546247 18:37966593-37966615 CACATTTGTCACTTTCTACTGGG + Intergenic
1156856897 18:41792448-41792470 TACCTTTTTGACTTTCCACATGG + Intergenic
1157511707 18:48280063-48280085 CACATTTGGTTCTTGCCCCAAGG + Intronic
1158169413 18:54579514-54579536 CACATTTGTTTCTTTTATCAAGG - Intergenic
1158556748 18:58481509-58481531 TATATTTGTGTATTTGCACATGG - Exonic
1159513879 18:69432591-69432613 CATATTTCTGTATTTCAACAAGG + Intronic
1162089763 19:8271458-8271480 CTCATTTTTTTCTTTCAACAGGG - Intronic
1162437858 19:10673453-10673475 CAGATTTGTGTTCTTTCACATGG + Intronic
1163192477 19:15687483-15687505 CACTATTCTGTCCTTCCACATGG - Intronic
1163200844 19:15767850-15767872 TACTTTTTTGTCCTTCCACAGGG + Intergenic
1165051705 19:33145963-33145985 CCCATGTCTGTCTTTTCACAGGG - Intronic
1166576897 19:43850131-43850153 CACATTAGTTTCATTCCTCATGG + Exonic
926675617 2:15617768-15617790 CACATTTATGTCCTTCCAGATGG - Intronic
926725170 2:15992044-15992066 CACAATTGTCTCTTTACACAGGG - Intergenic
929660221 2:43776505-43776527 CACATTTGGGTCTTCCCCTACGG - Intronic
929808292 2:45167978-45168000 CGCTTTTGTGTTTTTCCACAGGG - Intergenic
929908328 2:46066119-46066141 CACTTCTGTGTCTTTCCTCTAGG - Intronic
930312747 2:49762388-49762410 CAAATTTTAGTTTTTCCACAAGG + Intergenic
932299231 2:70654117-70654139 TTCATTTGTGCCTTTGCACAAGG - Intronic
932920505 2:75908930-75908952 AACATTTGTCTTTTTTCACATGG - Intergenic
933945323 2:87281228-87281250 AACATTTGTGTCTTTGTATAAGG + Intergenic
933976614 2:87517210-87517232 CACATTTGTGTCTTTCCACAGGG - Intergenic
935205636 2:100894406-100894428 CATGTTTGTGTCTCTCCACAAGG + Intronic
935382980 2:102471849-102471871 TTCATTTTGGTCTTTCCACAAGG + Intergenic
935714149 2:105925129-105925151 CCCATTTGTGTCTTTCCCCAAGG + Intergenic
935737347 2:106116842-106116864 AACGTTTGTGTCTTTCCACAAGG - Intronic
936237808 2:110759554-110759576 CCCATGTGTGTCTTTGCACATGG + Intronic
936317205 2:111433594-111433616 CACATTTGTGTCTTTCCACAGGG + Intergenic
936334886 2:111580363-111580385 AACATTTGTGTCTTTGTATAAGG - Intergenic
937468692 2:122156833-122156855 CACATTTGTGGATCTCCAAAAGG + Intergenic
937898891 2:127000931-127000953 CACATTTCTGTCTTTTTATAAGG + Intergenic
938778457 2:134562271-134562293 CATATTTGTCTCTATCCTCAGGG + Intronic
939035191 2:137122469-137122491 CACTTCAGTGTCTTTACACATGG - Intronic
942472858 2:176280569-176280591 CACATTTGTGTCTTTCCACAAGG + Intronic
944676557 2:202037272-202037294 CACAGTTATGCCTTTCCACAGGG - Exonic
945674698 2:212841912-212841934 AACATTTTTGTTTTTCCAGAGGG + Intergenic
947066280 2:226229125-226229147 CATATTTGTGTAATTCAACATGG + Intergenic
948031601 2:234822235-234822257 CACATTCTTGTCATTCTACAGGG + Intergenic
1170426294 20:16238331-16238353 CAGATGTGGGCCTTTCCACAGGG + Intergenic
1170464128 20:16607583-16607605 TACATTGGGGTCTTTCCAAATGG + Intergenic
1170514400 20:17113458-17113480 CACATATATCTCTTTCCACAGGG - Intergenic
1170523667 20:17215063-17215085 CACATTTGTGCCTGTCTTCATGG + Intergenic
1171193274 20:23176960-23176982 CTTATTTCTGTCTTTTCACATGG + Intergenic
1171418582 20:25000810-25000832 CACTTTTGTTTTTTTACACAAGG + Intergenic
1171467369 20:25339447-25339469 CACATATTTTTTTTTCCACAAGG + Intronic
1173967413 20:47123398-47123420 CACGTTTATGTCTTTCCACAAGG + Intronic
1174096651 20:48095003-48095025 CACGTTTGTATCTTTCCACAAGG - Intergenic
1176120292 20:63451536-63451558 CGGGTTTGTGTCTTTCCACAGGG - Intronic
1176998548 21:15583811-15583833 CATGTTTGTATCTTTCCACAAGG + Intergenic
1177958338 21:27629272-27629294 CCTATGTGTGTCTTTGCACATGG - Intergenic
1178161566 21:29923065-29923087 CAAAAATGAGTCTTTCCACAGGG + Intronic
1181048963 22:20229772-20229794 CCCATGTGTGTGTGTCCACATGG - Intergenic
1181294061 22:21820651-21820673 AACATTTGTTGCTTTTCACACGG - Intronic
1182682262 22:32089389-32089411 CACAATTCTGTCTTTCCTCTAGG - Intronic
1182852318 22:33485863-33485885 TACATTTATGTATTTCCCCAGGG + Intronic
951031229 3:17884226-17884248 ATCAAGTGTGTCTTTCCACAAGG - Intronic
951369527 3:21828518-21828540 GACATTTATGTCTTTCCATAAGG + Intronic
951472410 3:23070616-23070638 CATGTTTGTGTCTTTCCATAAGG - Intergenic
952869976 3:37890145-37890167 CACATGTGTGATTTTCCAAATGG - Intronic
953162783 3:40436855-40436877 CACATTTGTGTCCTTTCTCCTGG - Intergenic
953785076 3:45905424-45905446 CAAATATGTGTCTTTCCAACAGG + Intronic
954922587 3:54204436-54204458 CACATTCGTGGCTTTCCTCAAGG - Intronic
956083764 3:65587988-65588010 CACATTTGGTTCTTTTCCCAAGG + Intronic
956487998 3:69741455-69741477 CTCATTTGGGTTTTTCCAGATGG - Intronic
957167387 3:76692293-76692315 CACATTTGTTTCCTTGCAAAGGG - Intronic
957320385 3:78622850-78622872 GACCTCTGTCTCTTTCCACATGG - Intronic
957825811 3:85441701-85441723 CACCACTGTGTCTTTCTACAAGG - Intronic
957845494 3:85728691-85728713 CACATTTGCGTGATTCCATAAGG - Intronic
958469032 3:94495314-94495336 CACATTCCTGTCTTTCCCCAAGG - Intergenic
958531099 3:95330846-95330868 CATGATTTTGTCTTTCCACATGG + Intergenic
959019485 3:101172909-101172931 CAGATTCCTGTGTTTCCACAAGG + Intergenic
960635486 3:119780783-119780805 CACATTTCTGATTATCCACATGG - Intronic
961016858 3:123475224-123475246 CACATTTCTTTCCTTCCACCTGG + Intergenic
961473886 3:127135283-127135305 CACATTTGTGTCCATGCACGCGG + Intergenic
962772306 3:138624030-138624052 CTCATTTTTTTCTTTCCAGAAGG + Intronic
963072007 3:141312083-141312105 CACGTTTGTGTCTTTCCGCCAGG + Intergenic
963541045 3:146588598-146588620 CTCATTTGTTTCTTTTCACCTGG - Intronic
964481048 3:157138660-157138682 CACATGTGTACCTTTCCAGAAGG - Intergenic
964558469 3:157966673-157966695 CAGATTTTTGTCTTTCAACATGG - Intergenic
964652940 3:159032402-159032424 CACATTTTTTTCTTTCTATATGG + Intronic
965547488 3:169931249-169931271 CACATTTATATCATTACACATGG + Intronic
967460570 3:189741303-189741325 CATTTTTGTGTCCTTCCACATGG - Intronic
967667782 3:192194518-192194540 AACATCTGGGTATTTCCACATGG + Intronic
969237176 4:5873739-5873761 GACCTCTGTGTCTTTCCCCATGG - Intronic
971335751 4:25722537-25722559 CACATCTGAGTCTTTCCATAAGG + Intergenic
971396870 4:26236533-26236555 CAAATTAGTTCCTTTCCACATGG + Intronic
971478731 4:27095610-27095632 CACTTTAGTGACTTGCCACAGGG + Intergenic
972153031 4:36119647-36119669 CACTTGGGTGTCTTTCCACTTGG + Exonic
972224125 4:36992128-36992150 CACACATGTGTGTTTCCATATGG - Intergenic
973241293 4:47958321-47958343 CTCATTGATGTCTTTACACAGGG - Intronic
974612589 4:64234977-64234999 CTCTTTTCTGTCTTTCCACCAGG + Intergenic
976024745 4:80673905-80673927 CTTATGTGTGTCTTTGCACATGG + Intronic
977011251 4:91636415-91636437 CACTTTTGTGACATTCCAAAAGG + Intergenic
977503730 4:97876343-97876365 CACATTTGAGCATTTCCACTAGG - Intronic
978727130 4:111982746-111982768 CCTTTTTGTGTCTCTCCACAGGG - Intergenic
979109486 4:116734040-116734062 CATGTTTGTGTCTTTCTACAAGG - Intergenic
979669701 4:123349146-123349168 TACATTTGTATCTTGCCACAAGG + Intergenic
979972284 4:127150336-127150358 AATATTTGTGTCTTCCCTCAAGG - Intergenic
980196630 4:129597124-129597146 CATATCTGTGACTTCCCACATGG + Intergenic
982093488 4:151899649-151899671 CACAGTTGTGTGGTCCCACATGG + Intergenic
982795656 4:159640711-159640733 CAAAATTGTGCCTTCCCACAGGG - Intergenic
982851630 4:160324065-160324087 CATATTTTTGTCTTTACAAATGG + Intergenic
983403305 4:167293111-167293133 CACATTTTTGTTATTTCACAGGG + Intergenic
983560455 4:169096424-169096446 CACATTTGTGGACTTCCAGATGG - Exonic
983574353 4:169244237-169244259 CACATTTGTGTGTTTGTGCAGGG - Intronic
984856722 4:184201734-184201756 CACATTTTTTTTTTTCCTCAGGG + Intronic
986226047 5:5813658-5813680 CTCATTTGTGTGTTTGCATAGGG - Intergenic
987227367 5:15856779-15856801 CATACTTGTGTTTTTCCACTTGG + Intronic
987393609 5:17400038-17400060 CACACTTGTACCTTTCCACTAGG - Intergenic
987525433 5:19044390-19044412 CACAATTTTGTCTTTCCAAGTGG - Intergenic
988592436 5:32560787-32560809 GGCATTTGTGTCTTTCTACAAGG + Intronic
989162909 5:38408923-38408945 CACATTTGTGTCTTTCCAGGTGG + Intronic
989289738 5:39749098-39749120 CAGATTTGTTCCTTTCCCCAAGG - Intergenic
990033483 5:51290848-51290870 CACATATGAGTCTTTCCCAAAGG + Intergenic
990627590 5:57632019-57632041 GCCATGTGGGTCTTTCCACAGGG - Intergenic
992323325 5:75635851-75635873 CTCATTTATGTCTTGCCACTGGG - Exonic
993007558 5:82444692-82444714 CACATTTGTGTCTTCAGCCAGGG - Intergenic
993736861 5:91487806-91487828 CACACTTCTTTCTCTCCACATGG + Intergenic
995613490 5:113935806-113935828 CACGTTTGTGTCCTTCCACAAGG - Intergenic
996486558 5:124042052-124042074 CACTTGTGTGTCTGTCCACTAGG - Intergenic
998231733 5:140365227-140365249 CAAATCTGTGTGTTTCCACCAGG - Intronic
998783483 5:145684084-145684106 CCCTTTTGTCTCTTTTCACAAGG - Intronic
999837150 5:155386516-155386538 CACACTTCTGCCTCTCCACATGG + Intergenic
1000282652 5:159795401-159795423 CATATTTGTGTCTTTCCACAAGG + Intergenic
1000470647 5:161636801-161636823 CTCTTTTGTGTCTGACCACATGG - Intronic
1000865522 5:166509489-166509511 CACATTTGTTTCTTTTCCAATGG - Intergenic
1003165664 6:3676090-3676112 CCTATGTGTGTCTTTGCACATGG + Intergenic
1005367483 6:25093684-25093706 CACCTTTGTGTCTTTAAGCAAGG - Intergenic
1006255257 6:32827641-32827663 CACCTTTGTGCCTTTGCATATGG - Intronic
1007366788 6:41399724-41399746 CCCATGTGGGCCTTTCCACAGGG - Intergenic
1007926349 6:45652561-45652583 CACATATGTCTCCTTCCAAATGG + Intronic
1008275655 6:49540906-49540928 CACATTTGTATGTCTTCACATGG + Intergenic
1008669836 6:53756227-53756249 CAAATTTCTGTCTTCACACATGG - Intergenic
1010515244 6:76765222-76765244 CACCTTTGTTTCTTTCCCCTAGG - Intergenic
1011229936 6:85149476-85149498 CCCATGTGTGTCTTTTTACATGG + Intergenic
1012099117 6:95007937-95007959 CACATTTGTGTATCTAAACATGG - Intergenic
1014622995 6:123692545-123692567 CACAATTTTGTCTTTGCATAGGG - Intergenic
1015643081 6:135358186-135358208 CACAATGTTTTCTTTCCACAGGG - Exonic
1016235387 6:141857638-141857660 CACATTTGCATCCCTCCACAAGG - Intergenic
1016361358 6:143270804-143270826 CACATTTGTGTGTGTGCACATGG + Intronic
1017281833 6:152633997-152634019 CACAACTGTGTTTTTTCACAGGG - Intronic
1017702273 6:157086631-157086653 CACATGTCTGTCCTTCCAAATGG + Intronic
1017999871 6:159569632-159569654 CACCTATGTGTCTCTCCACTTGG - Intergenic
1018160637 6:161038854-161038876 CACATATGTGTCTGTTCACTTGG + Intronic
1019073239 6:169366845-169366867 CACAGCTGTGTCTTCCCTCAGGG - Intergenic
1019451909 7:1103228-1103250 CACACTTGTCTTTTACCACAGGG - Intronic
1021421304 7:20448231-20448253 AACATTTTTGTCTTTCAAAATGG - Intergenic
1021438981 7:20656083-20656105 CACATTTTATTTTTTCCACAAGG - Intronic
1022692725 7:32672936-32672958 AGCATTTGGGTCTTTCCAGATGG - Intergenic
1022855800 7:34312509-34312531 AACATTTGTGTCTATCAACTTGG + Intergenic
1022920399 7:35007460-35007482 AGCATTTGGGTCTTTCCAGATGG - Intronic
1023453696 7:40315319-40315341 CACTTCTGTGTCTTTCAAAATGG - Intronic
1024149320 7:46553826-46553848 CACATTTGTATCTTTCCCTAAGG - Intergenic
1024380645 7:48691986-48692008 CACATTTGTATCTACCCAAAAGG - Intergenic
1024454135 7:49583527-49583549 CACATTCGTGTCTTTCCACAAGG - Intergenic
1027433396 7:78137518-78137540 CAACTTGGTTTCTTTCCACATGG + Intronic
1027576025 7:79932295-79932317 CCTATGTGTGTCTTTGCACATGG + Intergenic
1027710196 7:81591221-81591243 CACTTTTGTGTTTTTCCCCCTGG + Intergenic
1030078215 7:105754959-105754981 AACATTTATGTCTGTCCCCAGGG - Intronic
1030106899 7:105995134-105995156 CACATTTGTGTCTTTCCATAAGG + Intronic
1030194576 7:106841063-106841085 CACATTTCTCTCTTTCCACCAGG + Intergenic
1030301197 7:107976518-107976540 CCCATTCTTGTCTTTGCACAGGG + Intronic
1030616313 7:111741821-111741843 TACATTTGTGTTTTCCCAAAAGG + Intronic
1032222016 7:130001494-130001516 CACATTTATCTCTGCCCACAGGG + Intergenic
1034732944 7:153403777-153403799 CACGTTTGTCTCTCTCCACAGGG + Intergenic
1034929058 7:155146090-155146112 CACACTTGTGTGTCTCCACAAGG - Intergenic
1035526764 8:319338-319360 CACATTTTTGTCATTCCCTAAGG + Intergenic
1037916176 8:22774839-22774861 CAGATTGGTTTCTTTCCATATGG - Intronic
1039069993 8:33640943-33640965 TATGTTTGAGTCTTTCCACAAGG + Intergenic
1039223896 8:35366312-35366334 CCCATTTCTCTCTTGCCACATGG + Intronic
1040091788 8:43406511-43406533 CTTATGTGTGTCTTTGCACATGG + Intergenic
1040557934 8:48497478-48497500 CACTTTTGCGTTTTGCCACATGG + Intergenic
1042720575 8:71822505-71822527 CCTATTTGTGTCTCTGCACATGG - Intergenic
1043368042 8:79558541-79558563 CCTATGTGTGTCTTTGCACATGG + Intergenic
1043528448 8:81122555-81122577 CACATTTTTCTTTTTTCACAAGG + Intergenic
1044880802 8:96720059-96720081 CACTATTTTGTCTTTCCAAATGG + Intronic
1046267564 8:111850084-111850106 CACATTTATGGATTTGCACATGG + Intergenic
1046627449 8:116590266-116590288 CTCATTTGTGTTTTTCCACGAGG + Intergenic
1046832430 8:118761303-118761325 CTCCTTTGTGTGTGTCCACATGG - Intergenic
1049002975 8:139837842-139837864 CCCATGTCTGTCTGTCCACAGGG + Intronic
1050476571 9:6046772-6046794 CACAATTTTGTCTTTCCAACTGG + Intergenic
1052331857 9:27278579-27278601 CACATTTGTGTCATTCAAGGAGG + Intergenic
1052737665 9:32359937-32359959 GACATTTTTGTATTGCCACAGGG - Intergenic
1056634701 9:88321890-88321912 CAAGTTGGTGTCTTTCCACAAGG - Intergenic
1056721032 9:89072210-89072232 CACATTTGTGTCTTTCCACAAGG - Intronic
1056769603 9:89467280-89467302 CAGATGTGTGTGTTTTCACAAGG - Intronic
1058058899 9:100474537-100474559 CCCATTTATGTCTTTTCAAAGGG + Intronic
1058069941 9:100591613-100591635 CCCATCTGTGTCTTTGCTCAAGG + Intergenic
1059554218 9:115262648-115262670 CACCATTGTGTCTTACCACCAGG - Intronic
1060570269 9:124632452-124632474 CACATGTATGTCTTTTCAGAAGG + Intronic
1061753045 9:132793952-132793974 CACATTTGAAACCTTCCACAGGG + Intronic
1185990072 X:4884033-4884055 CATGTTTGTGTCTTTCTATAAGG - Intergenic
1186038127 X:5446706-5446728 TATATCTGTGTCTTTCCACAAGG + Intergenic
1186204364 X:7186009-7186031 CATATTTGTGTCTTTCCACGAGG + Intergenic
1186683956 X:11904926-11904948 CACAGTTGTTTGTATCCACAAGG + Intergenic
1187134907 X:16538742-16538764 CACATTTCTGTATGTCCTCAAGG - Intergenic
1187259975 X:17676491-17676513 CAGATTTGTGTCATTCACCAAGG + Intronic
1187951373 X:24474197-24474219 CTCAATTGTCTCTTTCCAAAGGG + Intronic
1188393786 X:29655343-29655365 CACATTTGTGTTTTCCAACATGG - Intronic
1188463975 X:30457267-30457289 CACATTTTTGTCTTTATTCAAGG + Intergenic
1188636721 X:32442461-32442483 CTCATTTGTGTCAATCAACATGG - Intronic
1188726947 X:33597259-33597281 CAGATTTCTTTCTTTCCACATGG + Intergenic
1190617546 X:52251220-52251242 CACCCTTGTCTCTTTCCTCAGGG + Intergenic
1192020026 X:67378932-67378954 CACATTTTTTTCTTGGCACATGG + Intergenic
1192070883 X:67940241-67940263 CACAACTGTGGCTTTCCCCAGGG + Intergenic
1194090697 X:89579932-89579954 TTCATTCGTGACTTTCCACAGGG + Intergenic
1197009513 X:121544465-121544487 CACAATTTTGTCTTTCCAAGTGG - Intergenic
1197356951 X:125446723-125446745 CCTATGTGTGTCTTTGCACATGG - Intergenic
1197800722 X:130345041-130345063 CATTTTTGTGTCATTCCACTTGG + Intronic
1200443349 Y:3235992-3236014 TTCATTCGTGACTTTCCACAGGG + Intergenic
1201232895 Y:11882261-11882283 CACAGATTTTTCTTTCCACATGG + Intergenic
1201384714 Y:13426304-13426326 CACCTTTGTGTAATTTCACATGG - Intronic
1201686545 Y:16710828-16710850 CATGCATGTGTCTTTCCACAAGG + Intergenic
1201787579 Y:17802645-17802667 AACATTTGTGGCTTTTCATATGG - Intergenic
1201813974 Y:18103343-18103365 AACATTTGTGGCTTTTCATATGG + Intergenic