ID: 1056721035

View in Genome Browser
Species Human (GRCh38)
Location 9:89072239-89072261
Sequence GCTCAAGGTCAGACATAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 7, 2: 11, 3: 28, 4: 144}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056721035_1056721042 12 Left 1056721035 9:89072239-89072261 CCTGGTTATGTCTGACCTTGAGC 0: 1
1: 7
2: 11
3: 28
4: 144
Right 1056721042 9:89072274-89072296 GGAGGCCCACCCCGAGGCCAGGG No data
1056721035_1056721041 11 Left 1056721035 9:89072239-89072261 CCTGGTTATGTCTGACCTTGAGC 0: 1
1: 7
2: 11
3: 28
4: 144
Right 1056721041 9:89072273-89072295 GGGAGGCCCACCCCGAGGCCAGG No data
1056721035_1056721036 -10 Left 1056721035 9:89072239-89072261 CCTGGTTATGTCTGACCTTGAGC 0: 1
1: 7
2: 11
3: 28
4: 144
Right 1056721036 9:89072252-89072274 GACCTTGAGCTGCTTATGACAGG No data
1056721035_1056721037 -9 Left 1056721035 9:89072239-89072261 CCTGGTTATGTCTGACCTTGAGC 0: 1
1: 7
2: 11
3: 28
4: 144
Right 1056721037 9:89072253-89072275 ACCTTGAGCTGCTTATGACAGGG No data
1056721035_1056721039 -6 Left 1056721035 9:89072239-89072261 CCTGGTTATGTCTGACCTTGAGC 0: 1
1: 7
2: 11
3: 28
4: 144
Right 1056721039 9:89072256-89072278 TTGAGCTGCTTATGACAGGGAGG No data
1056721035_1056721040 6 Left 1056721035 9:89072239-89072261 CCTGGTTATGTCTGACCTTGAGC 0: 1
1: 7
2: 11
3: 28
4: 144
Right 1056721040 9:89072268-89072290 TGACAGGGAGGCCCACCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056721035 Original CRISPR GCTCAAGGTCAGACATAACC AGG (reversed) Intronic
901380036 1:8866973-8866995 GCTCAAGGTCACACTTAACAAGG + Intronic
902573122 1:17359542-17359564 GTACAAGGTCAGACGTGACCAGG + Intronic
904566729 1:31432786-31432808 GCTCAAGGTCACACAGAAAATGG + Intronic
906867462 1:49438141-49438163 GCTCAAAGCCAGACAGAATCAGG + Intronic
907767197 1:57423547-57423569 GCTCGAGGTCCGATATAGCCAGG + Intronic
917376912 1:174358607-174358629 GCTCAAAGTAAAACAGAACCAGG - Intronic
918662622 1:187108039-187108061 CTTCAAGGACAGAAATAACCTGG - Intergenic
920714350 1:208325745-208325767 GTTCAAGGCCAGACTTAACTGGG - Intergenic
924319169 1:242829998-242830020 GCTCAAGGTCACACAGAACTGGG + Intergenic
1063135009 10:3208699-3208721 GCTCAGGGTGAGGCACAACCAGG - Intergenic
1064918099 10:20484842-20484864 GCACAAGTTCAGACATAACCAGG - Intergenic
1065114782 10:22474882-22474904 GCTCAAGGTCATAAAAAACAAGG + Intergenic
1065221837 10:23503825-23503847 GCTCAACGTCAGTTACAACCAGG - Intergenic
1068716058 10:60189995-60190017 GCTTGAGTTCAGGCATAACCTGG - Intronic
1069175524 10:65284886-65284908 GCACAAGGTCAGAGATAGCCAGG - Intergenic
1070527194 10:77305484-77305506 GCACAAGGTCAGAGAGAACTGGG - Intronic
1070950352 10:80426077-80426099 GCTCCAGGCCAGACATACCTGGG - Intronic
1078925137 11:15868010-15868032 GCACAAGATAAGATATAACCAGG + Intergenic
1080582494 11:33655753-33655775 GCCCAAGGTGAGACAGAACTTGG + Intronic
1082280488 11:50266579-50266601 GGTCAAGGTAAAACATATCCTGG + Intergenic
1082705422 11:56488590-56488612 GCACAAGGTCAGAGATAACTAGG - Intergenic
1084213046 11:67632584-67632606 GGTCAGGGTCAGACAGTACCAGG + Exonic
1088999527 11:115039948-115039970 GCTGTAGGTCAGGCATAACATGG + Intergenic
1090510573 11:127370344-127370366 GCGCAAGGTCAGACATAACCAGG + Intergenic
1090726384 11:129530806-129530828 GGCCAAGGTCAGCCATCACCAGG + Intergenic
1101579335 12:106027681-106027703 GGTCAAGGTGAGACACAACTGGG - Intergenic
1105625332 13:22107114-22107136 GCGCAAGGTCAAACATAACCAGG - Intergenic
1106477004 13:30107663-30107685 GCTCATGGTCTGACACATCCAGG - Intergenic
1106704319 13:32264679-32264701 GCTCTAGGGCAGGCAGAACCAGG - Intronic
1106874909 13:34061003-34061025 GTACAAGGTTAGAGATAACCAGG - Intergenic
1107333619 13:39329462-39329484 ACGTAAGGTCAGAGATAACCAGG + Intergenic
1107665992 13:42691240-42691262 GCTCAACATCACAAATAACCAGG - Intergenic
1107789349 13:43985926-43985948 GGTCAAGGTCAGAGGCAACCTGG - Intergenic
1111559043 13:89920154-89920176 GCACAAAGTCAGAGATAACCAGG + Intergenic
1113750194 13:112771601-112771623 GTGCAAGGTTAGAGATAACCAGG + Intronic
1113830932 13:113295474-113295496 GCACAAGGTCAGACATAACCAGG + Intergenic
1114571090 14:23669377-23669399 GCCCAAGGTTAGAGATAACCAGG - Intergenic
1115256305 14:31406548-31406570 TCCCAAGGTCACACAGAACCTGG + Intronic
1116107091 14:40522875-40522897 GCATAAAGTCAGACATAACCAGG + Intergenic
1117011152 14:51472039-51472061 GTTCAAGATCAGGCATTACCAGG - Intergenic
1117641838 14:57808276-57808298 GCTCAAAGTCAGACAGCAACTGG + Intronic
1119188265 14:72660450-72660472 CCTCTAGGTCAGACAGAACCAGG - Intronic
1121103998 14:91269190-91269212 GCGCGAGGTCAGGCATAACCAGG - Intergenic
1121369017 14:93340052-93340074 GCACAAGGTCAGACATAACCAGG - Intronic
1121530526 14:94649623-94649645 GCACAAGTTCAGTCATGACCTGG + Intergenic
1122080710 14:99265370-99265392 GCTAAAGGTGAGGCCTAACCAGG + Intronic
1122541620 14:102500924-102500946 GCTCAAGGTCACACAGCACTGGG + Exonic
1123874558 15:24610695-24610717 GCACAAGGTCAGACATAAGCTGG - Intergenic
1124076904 15:26454837-26454859 GTGCGAGGTCAGAGATAACCAGG - Intergenic
1126647063 15:50885182-50885204 GCACTAGGTTAGACATAAACTGG + Intergenic
1127484406 15:59405883-59405905 GCTCTAAGGCAGACATAATCGGG - Intronic
1128306560 15:66602905-66602927 GCATAAGCTCAGACATAACCAGG - Intronic
1129830281 15:78664743-78664765 GTTCAAGTTCAGAAGTAACCAGG - Intronic
1133200278 16:4200077-4200099 GCTAAAGCTCAGTCCTAACCAGG + Intronic
1133471503 16:6080322-6080344 CCTGAAGGTCAGAGATACCCAGG - Intronic
1133569563 16:7027473-7027495 GCCCAAGGTCAGGCAGAGCCAGG + Intronic
1138235036 16:55374908-55374930 GCTACAGGTCACACATAACAAGG + Intergenic
1140395543 16:74623394-74623416 CTTCAAGGTCAGAAATAAACCGG + Exonic
1143375363 17:6463978-6464000 GGTCAAGGTCAGAGAGCACCTGG + Intronic
1145782129 17:27570299-27570321 GCTCAAGGCCACACAGAACAAGG - Intronic
1147437749 17:40428078-40428100 TCTAGAGGACAGACATAACCTGG - Intergenic
1151010081 17:70483981-70484003 GCTCAAGGTCAGGCCTCACTGGG + Intergenic
1151246860 17:72802024-72802046 GCACAAGGTAAGACATTCCCTGG + Intronic
1153932917 18:9894821-9894843 GCACAAGATCAGACATAGCCAGG + Intergenic
1156672305 18:39485677-39485699 GCTCAAGGCCATACAGAACTAGG + Intergenic
1159962956 18:74569607-74569629 CCGCATGGTCAGAGATAACCAGG + Intronic
1160001407 18:75027727-75027749 GTTCAAGGTCAGACAGAGGCTGG + Intronic
1160182397 18:76646865-76646887 GCTCAAGCTCACTAATAACCAGG + Intergenic
1163443705 19:17334469-17334491 GATCAGGGTCAAACGTAACCTGG - Intronic
1166184332 19:41129789-41129811 GCCCAAGGTCACACAGAAACAGG + Intergenic
1166972656 19:46580102-46580124 GCCCAAGGTCACACATAAACTGG + Intronic
1168640372 19:58027415-58027437 GTGCAAGGTCAGAGATAACCAGG - Intergenic
925286958 2:2722114-2722136 GCTCAAGGTCTGACGTGATCTGG - Intergenic
928879439 2:36081348-36081370 ACTCAAGGTCAGATATTACAGGG - Intergenic
929593400 2:43161128-43161150 GCTCAAGGGCATGCAGAACCAGG + Intergenic
931257655 2:60587428-60587450 GCTCAAGAGCAGACAAAAGCAGG - Intergenic
931668715 2:64627902-64627924 GCCCAAGGTCACACAGAGCCAGG + Intergenic
932030731 2:68181642-68181664 GTTCAAAGACAGACATAAACAGG + Intronic
933945320 2:87281199-87281221 GCACAGGGTCAGACATAACCAGG + Intergenic
933976618 2:87517239-87517261 GCACAAAGTCAGACATAGCCAGG - Intergenic
935205633 2:100894377-100894399 GCTCAGGGTCAGTGATAACCAGG + Intronic
935714146 2:105925100-105925122 ACACAAGGTCAGACATAATCAGG + Intergenic
935737350 2:106116871-106116893 GGGCAAGGTCAGACATAACCAGG - Intronic
936317201 2:111433565-111433587 GCACAAAGTCAGACATAGCCGGG + Intergenic
936334889 2:111580392-111580414 GCACAGGGTCAGACATAACCAGG - Intergenic
936542886 2:113366274-113366296 GCTCAAGGTCACACAGTACATGG - Intergenic
937530556 2:122822350-122822372 GCTCAAGGTAAAGCAGAACCAGG + Intergenic
937926764 2:127173871-127173893 GCTCCAGGTGAGAGATAAACAGG + Intergenic
938212834 2:129482989-129483011 ACTCAAGGACAGACTTACCCAGG + Intergenic
938973481 2:136453369-136453391 ACTCAAGGTCAGACAGAAAATGG + Intergenic
939015165 2:136894436-136894458 GCTCAAGGTCACACACAGCATGG - Intronic
940071090 2:149688935-149688957 GCTAAAGGTCAGAGAGAATCTGG + Intergenic
940221930 2:151361835-151361857 GCTCGAGGTCAGAGAATACCAGG - Intronic
946586899 2:221199712-221199734 GCTCAAGGTCACACACAGCAGGG + Intergenic
947052972 2:226067482-226067504 ATGCAAGGTCAGAAATAACCAGG - Intergenic
947102757 2:226639002-226639024 TTACAAGGTGAGACATAACCTGG - Intergenic
948186199 2:236023419-236023441 GCTCCAGTTCAGACAGAAACTGG + Intronic
1170066182 20:12312998-12313020 ACTTAAGGTCAGACACACCCTGG - Intergenic
1172009573 20:31838555-31838577 GTTCCAGGTCAGACAGAACAGGG + Intergenic
1172194138 20:33080604-33080626 GCTCTAGGTCAGAGATATCTGGG - Intronic
1173967410 20:47123369-47123391 GGGCAAGGTCAGATATAACCAGG + Intronic
1174096653 20:48095032-48095054 GCACAAGGTCAGACATAACCAGG - Intergenic
1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG + Intronic
1179661882 21:42881300-42881322 TCTCAAAGTAAGTCATAACCTGG - Intronic
1182218645 22:28740766-28740788 GTGCAAGGTCAGACATAACCAGG - Intronic
1183662186 22:39227760-39227782 GCTCAAGGCCAGCCATTTCCTGG + Intronic
1184165766 22:42726719-42726741 GTCCAGGGTCAGAAATAACCAGG - Intergenic
949266277 3:2160310-2160332 GGCCAAGGTCAAACATAAGCTGG + Intronic
949504477 3:4714189-4714211 TTTCAAGGGCAGAAATAACCCGG + Intronic
950748512 3:15109763-15109785 GTGCAAGGTCAGACATAACCAGG - Intergenic
951520071 3:23603142-23603164 GCTGAAGGCCAGACAGCACCAGG - Intergenic
957529739 3:81425884-81425906 CATCAAGATCAAACATAACCTGG + Intergenic
959316449 3:104813981-104814003 TCTCGAAGACAGACATAACCTGG + Intergenic
962332942 3:134496127-134496149 GTGCAAAGTCAGACATAACCAGG + Intronic
962444011 3:135449008-135449030 GCTCAATGCCAGACACAAACTGG + Intergenic
963184868 3:142403105-142403127 ACTCAAGGTTCGACATAATCTGG + Intronic
964298940 3:155266235-155266257 GCACACAGTCACACATAACCAGG - Intergenic
967292009 3:187930361-187930383 GCTGAAGGTCAGAAAGAATCTGG + Intergenic
968910019 4:3472882-3472904 GCTGAAGCTCAGCCACAACCTGG + Intronic
969296772 4:6274925-6274947 GCTCAAGGTCAAACAGCTCCAGG - Intronic
969387075 4:6859733-6859755 GCTCAAGGTCACACATGAAGTGG - Intronic
971335748 4:25722508-25722530 GCGCAAAGTCAGACATAACCAGG + Intergenic
972730618 4:41791209-41791231 GCTCAAGTTCACAAAGAACCTGG + Intergenic
974214111 4:58822241-58822263 GCTCAACATCAAACTTAACCTGG + Intergenic
984158813 4:176226314-176226336 TCTCAAGGTCAGAGAAAGCCTGG - Intronic
984765663 4:183398622-183398644 GCTTAAGGACAGACATTTCCTGG - Intergenic
984846497 4:184112324-184112346 GCTCAAGGGCAGTCAAAAGCAGG - Intronic
985256598 4:188076379-188076401 GCTCAAGGTCAGAGATAACCAGG + Intergenic
985371496 4:189289916-189289938 GTGCAAGGTCAGAGATAGCCAGG - Intergenic
986287255 5:6368879-6368901 GCTCAAGTCCTGAAATAACCAGG - Intergenic
986471673 5:8082454-8082476 GCTGAAGGTGAGACATGACATGG - Intergenic
987059545 5:14229142-14229164 GTTCTAGATCAGACATACCCTGG - Intronic
988101286 5:26682352-26682374 TATCAAGGTCACACCTAACCAGG + Intergenic
988592432 5:32560758-32560780 GCACAAGATCAGATATAACCAGG + Intronic
989021228 5:37012040-37012062 GCTCAAGCTCACTAATAACCAGG - Intronic
992273336 5:75088705-75088727 CCTCAAGGCCAGCCAGAACCAGG - Intronic
993911774 5:93692156-93692178 GCTCAAATTCACACATAACAAGG + Intronic
996311606 5:122112667-122112689 ACTTAAGGTCAGAGGTAACCAGG - Intergenic
997572328 5:134940379-134940401 GCACAAGGTCAGAAATAAACTGG - Intronic
997773525 5:136576576-136576598 GCTCAAAGGCAGAGCTAACCTGG + Intergenic
998429600 5:142059676-142059698 ACTCAAGGTCAGACCTCATCAGG + Intergenic
1000282649 5:159795372-159795394 GCACAAGGTCAGACATAACCAGG + Intergenic
1001010444 5:168093032-168093054 GCCCAAGGTCACACACAGCCAGG + Intronic
1001928803 5:175658318-175658340 GCCCAAGGTCAGGCACAGCCAGG - Intronic
1002869588 6:1155026-1155048 GCTCAAGGACAAAGAGAACCAGG + Intergenic
1003018721 6:2491040-2491062 GATGAAAGTCAGAGATAACCTGG - Intergenic
1007623678 6:43229945-43229967 GCTCAAGGTCAGACAGAACCAGG + Intergenic
1008304207 6:49881614-49881636 CCTCAAGGCCAGAATTAACCTGG - Intergenic
1008799741 6:55352050-55352072 GTGCAAAGTCAGAGATAACCAGG + Intronic
1013107863 6:107041281-107041303 GCCCAAGGTCACACAGAACCAGG - Intronic
1015110849 6:129589897-129589919 GCTGAAGGTCAGACAGCCCCTGG + Intronic
1018784841 6:167099895-167099917 GCGCAAGGTTGGAGATAACCAGG + Intergenic
1024149324 7:46553855-46553877 GCACCAGGTCAGACATAACCAGG - Intergenic
1024454137 7:49583556-49583578 GCACAACATCAGACATAACCAGG - Intergenic
1024991632 7:55239186-55239208 GTGCAAGGTTAGAAATAACCAGG + Intronic
1026431915 7:70356154-70356176 GCTACAGATCAGACATAACTAGG + Intronic
1029285614 7:99463831-99463853 GCTCATGGCCAGACAAAAACAGG + Intronic
1029595888 7:101537524-101537546 TCTCCAGGTCAGACACAGCCAGG + Intronic
1030106896 7:105995105-105995127 GTGCAAGGTCAGACATAACCAGG + Intronic
1030186488 7:106767162-106767184 GGGCAAAGTCAGAGATAACCAGG + Intergenic
1030192032 7:106819801-106819823 GTGCAAGGTTAGAAATAACCAGG - Intergenic
1033382464 7:140836168-140836190 GCTCAATGTCATACAATACCTGG + Intronic
1034929061 7:155146119-155146141 GTGCGAGGTCAGACATAACCAGG - Intergenic
1038018598 8:23534665-23534687 GCCCAAGGTCACACCTAACTGGG - Intronic
1038338366 8:26663302-26663324 GCTCAAGGGCAGAACCAACCTGG + Intergenic
1039406163 8:37314629-37314651 CCTCAAGGTCAGACATCTTCAGG - Intergenic
1044593431 8:93936005-93936027 GTGCAAGGTCAGAAACAACCAGG + Intergenic
1049403616 8:142441979-142442001 GCTCAAGGTCATGCATGACCAGG - Intergenic
1052452400 9:28648943-28648965 GCTTATGATCAGAGATAACCAGG + Intronic
1052903301 9:33813764-33813786 GCTCAGTGTCAGGCATCACCTGG - Intergenic
1053429139 9:38030461-38030483 GCTCTAAGTCAGGCATAACGGGG + Intronic
1053489683 9:38489180-38489202 GCTCAAGGTCACACAGCCCCAGG + Intergenic
1056425313 9:86469503-86469525 GTGCAAGGTCAGAAATAAACAGG + Intergenic
1056631040 9:88293387-88293409 GTGCAAGGTCAGAGATAACCAGG - Intergenic
1056721035 9:89072239-89072261 GCTCAAGGTCAGACATAACCAGG - Intronic
1057670024 9:97078489-97078511 GCTCAAGGTCACACAGCTCCAGG + Intergenic
1057678163 9:97152470-97152492 GCTCAGGGTCAGAAAGAAGCTGG + Intergenic
1059252136 9:112895291-112895313 GCACAAGGTCACACAGAGCCAGG + Intergenic
1060010739 9:120040952-120040974 GCTCAAAGTCATACAGAACAGGG - Intergenic
1060557308 9:124514673-124514695 GGTCAAGGTCACATACAACCAGG + Intergenic
1061217724 9:129231469-129231491 GCTCCAAGTCAGACAGACCCAGG - Intergenic
1187738688 X:22331159-22331181 GGTCAAGGGCAGACAAATCCAGG + Intergenic
1188984329 X:36755873-36755895 GGTTAAGGTCAGAGATAACTGGG - Intergenic
1189129252 X:38481233-38481255 GCTGAAGGTCAGACAGTACATGG + Intronic
1190108670 X:47575506-47575528 GCTCTGGGTCATACAGAACCAGG - Intronic
1193451357 X:81672159-81672181 GCTCAAGATCACAAATAATCAGG + Intergenic
1197317628 X:124987101-124987123 GCTAAAGGTAAGACATATTCTGG - Intergenic
1200255991 X:154583527-154583549 GCTGAAAATCAGACATAACCCGG - Intergenic
1200261778 X:154620876-154620898 GCTGAAAATCAGACATAACCCGG + Intergenic
1201633316 Y:16094096-16094118 GTGCAAGGTCAGAGATAGCCAGG - Intergenic
1201686542 Y:16710803-16710825 GTGCAAGGTCAGAGATTACCTGG + Intergenic