ID: 1056721036

View in Genome Browser
Species Human (GRCh38)
Location 9:89072252-89072274
Sequence GACCTTGAGCTGCTTATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056721035_1056721036 -10 Left 1056721035 9:89072239-89072261 CCTGGTTATGTCTGACCTTGAGC 0: 1
1: 7
2: 11
3: 28
4: 144
Right 1056721036 9:89072252-89072274 GACCTTGAGCTGCTTATGACAGG No data
1056721032_1056721036 19 Left 1056721032 9:89072210-89072232 CCTTGTGGAAAGACACAAATGTG 0: 6
1: 6
2: 12
3: 42
4: 276
Right 1056721036 9:89072252-89072274 GACCTTGAGCTGCTTATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056721036 Original CRISPR GACCTTGAGCTGCTTATGAC AGG Intronic
No off target data available for this crispr