ID: 1056722418

View in Genome Browser
Species Human (GRCh38)
Location 9:89083119-89083141
Sequence CCTTCCCCATGGAGGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 340}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056722418_1056722430 20 Left 1056722418 9:89083119-89083141 CCACCCTGCCTCCATGGGGAAGG 0: 1
1: 0
2: 3
3: 60
4: 340
Right 1056722430 9:89083162-89083184 AGAAGCCTTCAGAGTAGTGGAGG No data
1056722418_1056722432 27 Left 1056722418 9:89083119-89083141 CCACCCTGCCTCCATGGGGAAGG 0: 1
1: 0
2: 3
3: 60
4: 340
Right 1056722432 9:89083169-89083191 TTCAGAGTAGTGGAGGAGACAGG No data
1056722418_1056722428 17 Left 1056722418 9:89083119-89083141 CCACCCTGCCTCCATGGGGAAGG 0: 1
1: 0
2: 3
3: 60
4: 340
Right 1056722428 9:89083159-89083181 CCCAGAAGCCTTCAGAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056722418 Original CRISPR CCTTCCCCATGGAGGCAGGG TGG (reversed) Intronic
900092438 1:926225-926247 CCTCCCCGGTGGAGACAGGGGGG + Intronic
900153946 1:1196581-1196603 GCTTCTGCAGGGAGGCAGGGAGG - Exonic
900193175 1:1360024-1360046 CTCTCCCCATGGAGGGAGGACGG + Intronic
900265022 1:1753128-1753150 CCATTCCCAGGGAGGGAGGGAGG - Intronic
900589480 1:3453414-3453436 CCATCCCCTGGGAGGGAGGGTGG - Intergenic
900831967 1:4971892-4971914 GCTGCCCCAGGGAGGCACGGAGG - Intergenic
900970126 1:5987447-5987469 CTTTCACCATGGTGGCATGGTGG + Intronic
901326982 1:8372738-8372760 CCTTGCCCATGCAGACAGAGGGG + Intronic
901445688 1:9306599-9306621 TCTTCCCCTGGGTGGCAGGGAGG - Intronic
901624362 1:10615565-10615587 TCGGCCCCATGGAGGCAGGGTGG + Intronic
901866595 1:12110558-12110580 CCTTCGCCATGGAGACCAGGAGG - Intronic
901937434 1:12636472-12636494 GCTTCCCTTGGGAGGCAGGGTGG - Intergenic
902435810 1:16397594-16397616 CCTGGCCCATGGGGTCAGGGAGG - Exonic
902603481 1:17555880-17555902 CCTGCCCCACAAAGGCAGGGTGG - Intronic
902659716 1:17892633-17892655 TCTTCCCCAAGGAGGCTGGGTGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902877435 1:19349383-19349405 CCGTCCACATGGAGCCGGGGAGG - Intronic
903016155 1:20363476-20363498 CCCTCCCCAAGGAGGCAGCTGGG + Intergenic
905205738 1:36341967-36341989 CCTTCGCCTTTGAGGCGGGGAGG + Exonic
906344175 1:45004908-45004930 CAGTCCCCATGGAGGCAGCAGGG + Intronic
906659111 1:47570016-47570038 CCTTCCTCTTGGGGTCAGGGTGG - Intergenic
907053538 1:51345179-51345201 CCTTCCACTTTGGGGCAGGGAGG - Intergenic
907074930 1:51569412-51569434 CCTGCCACATGGAGGCGGGGTGG + Intergenic
907475255 1:54701160-54701182 CCTTCACCATGGAGGGCAGGAGG - Exonic
907526747 1:55058188-55058210 CCTGCCCCATGGGTGCTGGGGGG - Exonic
908131476 1:61080012-61080034 CCTCCCCCGCGGAGGGAGGGGGG - Intronic
910092906 1:83486657-83486679 CCTTGCCCTTGGAGGCAGGAGGG - Intergenic
911124080 1:94323867-94323889 CCTTCCCCCTGGCTACAGGGTGG - Intergenic
911994652 1:104750066-104750088 CTTTTCACATGGTGGCAGGGAGG + Intergenic
912379832 1:109241324-109241346 CCCTCCCCATGGGGGTGGGGTGG + Intergenic
912812991 1:112807877-112807899 TCTTCCACAGGGAGGCAGAGGGG + Intergenic
913689624 1:121266939-121266961 CCTTCCCCATGGCTGCCTGGAGG + Intronic
914147974 1:145013333-145013355 CCTTCCCCATGGCTGCCTGGAGG - Intronic
914426282 1:147580084-147580106 CCTATGGCATGGAGGCAGGGAGG - Intronic
916491853 1:165309108-165309130 ACTTCCAAATGGTGGCAGGGCGG - Intronic
918393748 1:184093324-184093346 ACTGCCCCTTGGAGGCAGGGTGG + Intergenic
920388267 1:205582879-205582901 CCCTGCCCCTGGAGGCAGGCTGG - Intronic
920409647 1:205749583-205749605 CCGTCCCCTTGGAGCCAGCGCGG - Intronic
920476947 1:206285413-206285435 CCTTCCCCATGGCTGCCTGGAGG + Intronic
920571602 1:207022158-207022180 CCGTGCCCAGGGAGGCCGGGCGG + Exonic
920630583 1:207647664-207647686 CCTTCCTCTTGGAGGCAGGAGGG - Intronic
920930643 1:210384606-210384628 GCTTCTCCATGGAAGCAGGGAGG - Intronic
921295054 1:213693604-213693626 CCTTCCTCAGGCAGGCAGGGTGG - Intergenic
922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG + Intergenic
922724350 1:227915502-227915524 CAGACCCCATGGAGGCAGTGAGG + Intergenic
922763179 1:228144843-228144865 CCTTTCCCTTGGGGGCTGGGAGG + Intronic
923017668 1:230139490-230139512 CCTGCCCCATGAAGGGAGGACGG + Intronic
924709128 1:246519549-246519571 CCTTCCCCATGGGGACAGTGAGG - Intergenic
1062760260 10:12088-12110 CCTAGCCCAGGGAGCCAGGGTGG - Intergenic
1062806086 10:420458-420480 CATTCCACCTGGAGGCAGGCAGG + Intronic
1063663672 10:8049807-8049829 CCTTCCCTATGGTGGGAGGAGGG - Intergenic
1066658896 10:37720801-37720823 CCTTCCACAGGGAGAAAGGGGGG - Intergenic
1067140878 10:43655553-43655575 CCCTCCCCATGGAGTGAGGAAGG - Intergenic
1067688228 10:48480719-48480741 CCTTCCTCATGGAGTCACTGTGG - Intronic
1067747800 10:48949497-48949519 CCTCCCCCTAGGAGGCAGGATGG - Intronic
1070357506 10:75655013-75655035 TCTTCCCCACGGAGGCAGCGAGG + Intronic
1071524057 10:86347966-86347988 CCTTCCCCATGGTCCCAGTGGGG + Intronic
1072548274 10:96457253-96457275 CTTTCCCTGAGGAGGCAGGGAGG - Intronic
1072820461 10:98551491-98551513 CCTGCCCCTTGGTGGGAGGGCGG - Intronic
1073527004 10:104192832-104192854 CCTTCCCCACTGAGCTAGGGTGG + Intronic
1074468411 10:113705152-113705174 CCTTCCCCAAAAAGCCAGGGTGG + Intronic
1075815452 10:125261352-125261374 GGTTCCCCATGGAGGAAGAGTGG + Intergenic
1076601080 10:131657530-131657552 CCCAGCCCATGGAGGCAGGTGGG - Intergenic
1076802574 10:132838025-132838047 CCTTCCCCAGGGGAGCATGGGGG - Intronic
1077183081 11:1225007-1225029 CCAACCCCATGGAGGCTGGGAGG - Intronic
1077195400 11:1277341-1277363 CCTTCCTCAGGGAGGCCGGTGGG - Intronic
1077481247 11:2815672-2815694 CCCTCCCTATGCAGGCAGAGGGG + Intronic
1077485309 11:2835795-2835817 CCTTCCTCATGGAGGCGGCGGGG + Intronic
1077529403 11:3088117-3088139 CCTGCTCCATGGAGGCAGAGAGG - Exonic
1078572723 11:12473507-12473529 CTTTCCTCAGGGAAGCAGGGAGG - Intronic
1080196132 11:29611599-29611621 CCTTCCCCAAAGGGGCAGGTGGG + Intergenic
1080273381 11:30474496-30474518 CCTTCCCAAGCCAGGCAGGGTGG - Intronic
1080578171 11:33618698-33618720 CCTTTCCCCTGAAGGCAAGGGGG + Intronic
1080636684 11:34130637-34130659 CCTGTCCAAAGGAGGCAGGGTGG - Intronic
1083292656 11:61698573-61698595 GCTTCCCCAGGGAAGCAGGTGGG - Intronic
1084684697 11:70686761-70686783 CCTTCCTCCAGGAAGCAGGGAGG - Intronic
1084965394 11:72741801-72741823 CCTTCCCTCTTGGGGCAGGGTGG - Intronic
1085104210 11:73827966-73827988 CCTTCCCCGTCTAGGCATGGCGG + Intronic
1085290436 11:75395353-75395375 CCTTCCCCAGGGATGCCAGGAGG - Intergenic
1085644296 11:78213214-78213236 CTGTCCAGATGGAGGCAGGGTGG + Intronic
1086218310 11:84409844-84409866 CCTTCCCGGTGAAGGGAGGGAGG - Intronic
1086945601 11:92841142-92841164 CCTTCCCCAGTGAGGCAGGAGGG + Intronic
1088388988 11:109292316-109292338 CCTTCCTCATGGCAGCAGGGTGG - Intergenic
1088724158 11:112619757-112619779 CCATCTCCATGGATGCAGGAGGG + Intergenic
1089690673 11:120185035-120185057 CCTTTGGCATGGAGGCAGAGGGG + Intronic
1089865282 11:121626289-121626311 CCTTCCCCTTGGAAGTGGGGTGG + Intronic
1090428568 11:126627518-126627540 CAGTCACCATGGAGCCAGGGAGG - Intronic
1091235270 11:134017950-134017972 CCTTCCCCCAGGAGGCAGGATGG - Intergenic
1091283347 11:134394610-134394632 CCTTGCTCATGGAGGAAGAGTGG + Intronic
1095894223 12:47264405-47264427 CCTTCCCTCTGGAGGCCTGGAGG + Intergenic
1095983369 12:47984925-47984947 CTTTCCCCAAGAGGGCAGGGAGG + Intronic
1096716837 12:53496461-53496483 CCTTACCCATGGAGGCCTCGGGG + Intronic
1097054281 12:56240521-56240543 CCTCCCCCATGAAGACTGGGGGG + Exonic
1100887848 12:99092227-99092249 CCATCCCCAGAGAGGTAGGGAGG + Intronic
1101831107 12:108257275-108257297 CCCAGCCCATGGAGGCAGGGTGG + Intergenic
1101877184 12:108603586-108603608 CCATGGCCAGGGAGGCAGGGAGG - Intergenic
1102848368 12:116213184-116213206 CCTTTCACAGGGAGGGAGGGAGG + Intronic
1103746804 12:123130454-123130476 CCTTCCCCTTGGAGCCAAGAAGG - Intronic
1104157257 12:126145322-126145344 GCTTCCCAATGGAGTCAGTGTGG + Intergenic
1104366231 12:128180290-128180312 CCCTCCATTTGGAGGCAGGGTGG + Intergenic
1104671448 12:130683316-130683338 CCTTCCCCCTGGAGGCTCTGTGG - Intronic
1106428772 13:29659181-29659203 CATGGCCCAAGGAGGCAGGGAGG - Intergenic
1107980473 13:45729960-45729982 TCTTCCCAATGTAGGCAGGTGGG + Intergenic
1108355498 13:49625688-49625710 TGGGCCCCATGGAGGCAGGGAGG - Intergenic
1110392215 13:74986963-74986985 CATTCCTCAGGGAGGGAGGGGGG + Intergenic
1112741580 13:102479459-102479481 CCAACCCCATGGAGCCAGGGTGG + Intergenic
1113379999 13:109795652-109795674 CCTTCCCCAGGAAGCCAGGTTGG - Intergenic
1114031596 14:18584492-18584514 CCTAGCCCAGGGAGCCAGGGTGG - Intergenic
1114689402 14:24566341-24566363 CCTTCCCCAAGGAAGCAGTATGG - Intergenic
1115153515 14:30312727-30312749 ACTTCTCCAAGGAGGCAGAGTGG - Intergenic
1115525643 14:34278181-34278203 CCCTACACATGGAGGGAGGGAGG + Intronic
1116560914 14:46377327-46377349 CCCTGCCCATGGAGGAAGGATGG + Intergenic
1118744410 14:68763334-68763356 CCATCCCTAGGGAGCCAGGGAGG - Intergenic
1118819322 14:69334766-69334788 CCTTCCTCAGGCAGACAGGGAGG - Intronic
1119186522 14:72646688-72646710 AATTCCGCATGGAGGCAAGGAGG - Intronic
1119320491 14:73727277-73727299 ACTTCCACACAGAGGCAGGGCGG + Intronic
1119485652 14:74984954-74984976 CAGTCCCCAGGGAGACAGGGAGG - Intergenic
1122194445 14:100074600-100074622 CCCTCACCATGGAGTCAGCGCGG - Intronic
1122297766 14:100714767-100714789 CCTAGGCCTTGGAGGCAGGGAGG + Intergenic
1122389055 14:101367921-101367943 CTGTGCCCATGGAGGCAGTGCGG - Intergenic
1122817095 14:104319214-104319236 CCCTCCCCATGGTGACAGGAGGG + Intergenic
1122898264 14:104771259-104771281 CCTGAGCCATGGAGGCAGGGTGG - Intronic
1123696250 15:22881052-22881074 ACTTCCCCATGGTGGCTGAGGGG + Intronic
1124155929 15:27225343-27225365 CCCTCCACGTGGAGGCAGGCAGG + Intronic
1129210183 15:74063894-74063916 TCTTAGCCATGGAGGCTGGGGGG - Intergenic
1129252408 15:74316173-74316195 CCTGCCCCATGAAGCCAGGGAGG - Intronic
1129391382 15:75222721-75222743 TCTTCCCCATGGAGGCGAGGGGG - Intergenic
1129403839 15:75301508-75301530 TCTTAGCCATGGAGGCTGGGGGG + Intergenic
1129870084 15:78934447-78934469 GCTCCCCCATGGAGGAAGGCAGG + Intronic
1130285707 15:82552800-82552822 CCTTCACCAGGGTGGGAGGGAGG - Intronic
1130381489 15:83375982-83376004 CCTTCCACATGGAGAAAGGCAGG - Intergenic
1130931171 15:88429162-88429184 CTTTCCCCCTGCAGGTAGGGTGG - Intergenic
1131137990 15:89953022-89953044 CCATCCACATGGGGGCGGGGAGG + Intergenic
1131383842 15:91986263-91986285 TCTTCCCCAGGAAGCCAGGGAGG - Intronic
1132237358 15:100232275-100232297 CCTGCAGCATGGAGCCAGGGTGG + Intronic
1132316433 15:100893658-100893680 AAGTGCCCATGGAGGCAGGGAGG + Intronic
1132549206 16:547439-547461 CCTTCCCCGGGGAGGCCAGGTGG - Exonic
1132678152 16:1129208-1129230 CCTGCCCCGAGGAGGCCGGGCGG + Intergenic
1133530529 16:6651251-6651273 TGCTCTCCATGGAGGCAGGGAGG - Intronic
1133555102 16:6898317-6898339 GCTTCCCCTTGGATGGAGGGGGG + Intronic
1133790958 16:9008839-9008861 CCTTCCCTAGGGGCGCAGGGAGG + Intergenic
1134061593 16:11202708-11202730 CCTGCCCCCTGGGGGAAGGGAGG + Intergenic
1135351253 16:21731038-21731060 CTTAGCCCTTGGAGGCAGGGAGG - Intronic
1135449733 16:22547164-22547186 CTTAGCCCTTGGAGGCAGGGAGG - Intergenic
1135668372 16:24354459-24354481 CCTTTTCCAGGGAGGCAGGGAGG + Intronic
1136427449 16:30178581-30178603 CCTTCTCCATGGAGAAAGTGTGG - Intergenic
1137536929 16:49334320-49334342 CCATCCTCTTGGTGGCAGGGTGG + Intergenic
1138349843 16:56340626-56340648 CATTCCACACGCAGGCAGGGCGG - Intronic
1138473908 16:57259355-57259377 TCTTCCCCCTGAAGGCAGAGAGG - Intronic
1138678911 16:58671240-58671262 CCTTCTCCATGTGGGCAGGGCGG - Exonic
1139424351 16:66869964-66869986 TATTTCCCATGGAGGCAGTGGGG + Intronic
1140275093 16:73501891-73501913 CCTTCCCCAGAGAGGTAAGGAGG - Intergenic
1140663483 16:77209405-77209427 CCTTCCCCACAGAGGCACTGAGG + Exonic
1141727360 16:85799024-85799046 CCTTCCCCTTGCAGGCAGCCTGG - Intronic
1141867009 16:86757318-86757340 CCTGGCCCATGGAGGCTGTGTGG - Intergenic
1141869120 16:86772638-86772660 TATTCCTCTTGGAGGCAGGGTGG - Intergenic
1142499229 17:323139-323161 GCTTCCCCATGGAAGGAGGGAGG + Intronic
1142809031 17:2386765-2386787 CCTTCCCCTAGGAGGCCTGGGGG + Exonic
1143204103 17:5131138-5131160 CCTTCCCCATGGGGACAGTGAGG - Intronic
1143204212 17:5131556-5131578 CCTTCCCCATGGGGACACTGAGG - Intronic
1143477426 17:7210930-7210952 CCACCCCCATGGAGGGAGGGTGG + Intronic
1144849428 17:18236596-18236618 CCGTCCTCATGGCTGCAGGGAGG - Exonic
1144875284 17:18394247-18394269 CCTTCCCCATGGGGACAGTGAGG - Intergenic
1145156940 17:20550174-20550196 CCTTCCCCATGGGGACAGTGAGG + Intergenic
1145759947 17:27420305-27420327 CCTTCCCCATGGGGACAGTGAGG - Intergenic
1145799104 17:27672046-27672068 CCTTCCCCATGGGGACAGTGAGG + Intergenic
1145900109 17:28485119-28485141 CCTTCCCCAGGCCAGCAGGGTGG - Intronic
1146002481 17:29139602-29139624 CCTTACCCTTGGTGGCTGGGAGG + Intronic
1146159910 17:30554229-30554251 CCTTCCCCATGGGGACAGTGAGG - Intergenic
1147383886 17:40070821-40070843 CCCACCCCATGCAGGCTGGGGGG - Intronic
1147384085 17:40071604-40071626 CCTGCCCCAAGGAGGCCGAGGGG - Intronic
1147597316 17:41725315-41725337 CCATCCCCCTGGTGGGAGGGAGG + Intronic
1147741921 17:42674863-42674885 CCTTGGCCAGGGAGGCAGTGTGG - Intronic
1147914635 17:43879113-43879135 CCTTCCACATCTATGCAGGGGGG + Intronic
1147927480 17:43954445-43954467 TCTTTCTCCTGGAGGCAGGGTGG + Intronic
1147949555 17:44099409-44099431 GACTTCCCATGGAGGCAGGGTGG - Intronic
1148029635 17:44610530-44610552 ATTTCCCCATGGAGGCACAGAGG + Intergenic
1148049122 17:44760482-44760504 CCTTCCTCTGGGAGGCAGGAGGG - Intronic
1148123394 17:45224951-45224973 CCTTCCCCTGGGAGGCACGCAGG + Intronic
1148215482 17:45831849-45831871 CCTCCCCCATGGAGGGGAGGGGG + Intronic
1148448528 17:47757147-47757169 CCTTACCCCTGGAGGGAGGAGGG - Intergenic
1148465960 17:47865484-47865506 CCTTCCCCAGGGTGGCTTGGAGG - Intergenic
1148486826 17:47996159-47996181 CCATCCCCAGGGAAGCAAGGTGG - Intergenic
1148784702 17:50140407-50140429 CCTTCCCAAGGGAGGCAGGAAGG + Intronic
1148807225 17:50270013-50270035 CATTTCACATGGAGGCAGAGTGG - Intergenic
1148815712 17:50326531-50326553 CATTCGCCATTGAGGCAGGCTGG + Intergenic
1149597565 17:57873270-57873292 CTTTCCCAAGGGAGGAAGGGGGG + Intronic
1149660683 17:58332638-58332660 TCCTCCCCAGGGAGGGAGGGAGG - Intergenic
1150633532 17:66897236-66897258 CCATTCCCAGGGAGGCTGGGAGG + Intergenic
1151783266 17:76261750-76261772 CCATCCCCACAGAGGCGGGGAGG + Intergenic
1151892173 17:76957278-76957300 CCTTGCCCCTGGAGACAGCGCGG - Intergenic
1151968540 17:77445080-77445102 CCGTCCCCAGGCAGGCATGGTGG - Intronic
1152065140 17:78108252-78108274 CCTTCCCCATGGGTGGGGGGGGG - Exonic
1152073951 17:78147410-78147432 CCTTCCTTATAGAGGCAGGTGGG + Intronic
1152461662 17:80445150-80445172 CCTTCCCCAGGGAGTCAGGGAGG + Intergenic
1152953168 18:12442-12464 CCTAGCCCAGGGAGCCAGGGTGG - Intergenic
1154086599 18:11311477-11311499 GCAGCCCCATCGAGGCAGGGTGG + Intergenic
1154201614 18:12304569-12304591 CCTTCCCCAGCGAGGCAGTGGGG + Intergenic
1156585501 18:38426861-38426883 CCTTCACCATGGAATCAGGTGGG - Intergenic
1159976007 18:74712596-74712618 CTGTCTCCCTGGAGGCAGGGAGG + Intronic
1160497973 18:79386305-79386327 CCACCCCCATGGAGGAAGCGAGG + Intergenic
1160694934 19:478954-478976 CCTTTCCCTTGGAGACAGGCAGG + Intergenic
1160745833 19:710264-710286 GCTTTCCCAGGGAGGGAGGGAGG - Intronic
1160792500 19:929182-929204 CCTTCCCCATGAAGGCCCTGGGG - Intronic
1161016569 19:1986448-1986470 CTATCCCCACGGAGGGAGGGCGG + Exonic
1161188457 19:2939030-2939052 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188465 19:2939065-2939087 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188474 19:2939100-2939122 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188483 19:2939135-2939157 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188492 19:2939170-2939192 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188501 19:2939205-2939227 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188510 19:2939240-2939262 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161596332 19:5152773-5152795 CCTGCCCCAGGGAGGGATGGAGG + Exonic
1161951136 19:7468843-7468865 CCTTCCCCGTTGAAGCTGGGAGG - Exonic
1162086910 19:8254784-8254806 CGTTTCCCAGGGAGGCTGGGGGG - Intronic
1162142480 19:8592904-8592926 GCTGCCCCAGGGAGGAAGGGAGG - Intronic
1162479934 19:10922106-10922128 CCTTCCCACTGGAGACAGGCAGG - Exonic
1162561963 19:11422272-11422294 GCTTCCCCAGGGAGGTGGGGCGG + Intronic
1165319356 19:35075958-35075980 CCCTCCCCAAGGACCCAGGGAGG - Intergenic
1165486487 19:36099694-36099716 CCCACTCCATGGGGGCAGGGAGG + Intronic
1167146065 19:47681267-47681289 CCTGCCCCAGGTAAGCAGGGCGG + Exonic
1167538529 19:50070855-50070877 CCTTCCCCATGGTGGTATTGTGG + Intergenic
1168462504 19:56570955-56570977 CCCTCACCAAGGAGGCAGGAAGG - Intronic
926157613 2:10465921-10465943 CCTTCCCCATCCAAGCATGGTGG - Intergenic
926663167 2:15491180-15491202 CCTGCTTCATGGAGGAAGGGTGG - Intronic
927156263 2:20223532-20223554 CCATCCCCAGGGATGCAGAGGGG - Intronic
929174183 2:38960287-38960309 GCTTCGCCATGGAGGCCGAGCGG + Exonic
930019628 2:46993675-46993697 CCTTTCCCACGCAGCCAGGGAGG + Intronic
931789169 2:65648135-65648157 CATCCCATATGGAGGCAGGGAGG + Intergenic
932448449 2:71794795-71794817 CCCTCCCCATGGAGCCAGGCAGG + Intergenic
932699567 2:73984190-73984212 CCCTCCTCTGGGAGGCAGGGCGG + Intergenic
933833748 2:86230120-86230142 CATGCCCCAGGGAGGCAGTGGGG - Intronic
933874455 2:86604680-86604702 CCTTACCCATGAAGCCAGTGTGG + Exonic
934660154 2:96138852-96138874 TCTGCCCCCTGGAGGCAGGAAGG - Intergenic
934962982 2:98694090-98694112 CCTTCACCATGGTGGGTGGGTGG - Intronic
935281546 2:101522188-101522210 CCTTCCACCTAGAGCCAGGGAGG + Intergenic
935621633 2:105135241-105135263 GCTACCCCATGGGGACAGGGAGG + Intergenic
937031937 2:118747928-118747950 CCTTCTCCCTGGAAGCAGGTGGG + Intergenic
938695494 2:133831703-133831725 ACTTCTCCATGTAGGCAGAGAGG - Intergenic
940017871 2:149125414-149125436 CATGGCCCCTGGAGGCAGGGTGG - Intronic
940895927 2:159081818-159081840 CCTGGCCCATGGGGCCAGGGAGG - Intronic
941307226 2:163885291-163885313 TCTTGCCCATGAATGCAGGGTGG + Intergenic
941715183 2:168756149-168756171 CCATCCTCATAGAGGCAGGATGG - Intronic
941905186 2:170713064-170713086 CCTTTCCCAGGGAGGCGGGCAGG - Exonic
942251788 2:174053641-174053663 CCTCCCCCATTGAAGCAGGCGGG + Intergenic
944667933 2:201972329-201972351 CCTGTCCCTGGGAGGCAGGGAGG + Intergenic
946031254 2:216706960-216706982 GCTTCCCCAGGCAGGCAGGTTGG - Intergenic
946115954 2:217462414-217462436 CCTTCACCATGGGGACAGGGTGG - Intronic
946138451 2:217667485-217667507 CTCTCCCCTTGGAGGTAGGGTGG + Intronic
946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG + Exonic
947856581 2:233328356-233328378 TGCTCCCCATGGAGACAGGGTGG - Intronic
948082230 2:235215795-235215817 CATCCCCCATGGAGGCTGGGAGG + Intergenic
948687113 2:239676439-239676461 CCAGCCGCATGCAGGCAGGGAGG + Intergenic
948892983 2:240916132-240916154 CCTTCCCCACGGCTCCAGGGTGG - Intergenic
1168898330 20:1338989-1339011 CATTCTCCATGGGGGCAGGATGG - Intronic
1169075184 20:2755834-2755856 CCTGCCACAGTGAGGCAGGGTGG - Intronic
1171059568 20:21943245-21943267 CCTCCACCATGGATGCAGGTGGG + Intergenic
1172006596 20:31822653-31822675 ACTTCAGCCTGGAGGCAGGGGGG - Intronic
1175132005 20:56796369-56796391 CCTTCCCCTGGGAGTCAGAGGGG - Intergenic
1175229069 20:57461969-57461991 CCGTCCCCAGGGAGGCCAGGAGG - Intergenic
1175544674 20:59770733-59770755 ATTTCTCCATGGGGGCAGGGTGG - Intronic
1175756865 20:61535706-61535728 CCCTCCCCATGGAGGCTCAGGGG - Intronic
1176425847 21:6547757-6547779 CATTGCCCCTCGAGGCAGGGCGG + Intergenic
1177705988 21:24705462-24705484 CCTTATCCATGGAAGCAGAGTGG + Intergenic
1178580244 21:33832038-33832060 CCTTCCCCTGGCAGGCAAGGAGG - Intronic
1179416006 21:41199316-41199338 CCCTCCAGAAGGAGGCAGGGAGG - Intronic
1179486741 21:41715434-41715456 CTTGCCCCATGGAGGCAAGATGG - Intergenic
1179534402 21:42042045-42042067 ACTGCCCCATGGAGGGAGGAGGG - Intergenic
1179701338 21:43156074-43156096 CATTGCCCCTCGAGGCAGGGCGG + Intergenic
1179794309 21:43773871-43773893 CCTTCCCCTCGGGGGCATGGAGG - Exonic
1179896791 21:44367565-44367587 CCCTCCCCATGGAATTAGGGTGG - Intronic
1179960823 21:44766249-44766271 CGCACCCCATGGAGGCAGAGGGG + Intergenic
1180056212 21:45360392-45360414 CCTTATCCAGGGAGGCAGGAGGG + Intergenic
1180455708 22:15511549-15511571 CCTAGCCCAGGGAGCCAGGGTGG - Intergenic
1180595492 22:16970241-16970263 ACTGCCCCAGGGAGGCAGGCGGG + Intronic
1180731717 22:17987363-17987385 CCTTCCTCCTGGAGGCAGCAGGG + Intronic
1181150720 22:20881349-20881371 TCCTCTCCATGGAGGGAGGGAGG - Intronic
1182684055 22:32107156-32107178 CCTGCCCCAGGGAGGCAGGAAGG - Intronic
1183469059 22:37996212-37996234 CCTTCCCCCAGCAGGCAGGAAGG + Intronic
1183686198 22:39362644-39362666 CCTTTCCCCAGGAGGCAGGATGG + Intronic
1183732742 22:39627835-39627857 CCTTCCCCATGGGGGCTGTCAGG - Intronic
1184525292 22:45019213-45019235 CCTTCCCGATAGAGGGTGGGAGG - Intergenic
1184658664 22:45955258-45955280 CCTTCCACATGGAGGCGAGGGGG + Intronic
1185281926 22:49975937-49975959 CCTTCCCTAAGGAGGCCGGAGGG + Intergenic
950218586 3:11177496-11177518 CCTTCCCCCTGGAGGAAATGGGG - Intronic
950416208 3:12870209-12870231 CCTTCCCCATGGAACCAAAGAGG + Intronic
950898435 3:16474753-16474775 CATTCCCCATGGAGCCAGTTGGG + Intronic
951788503 3:26452362-26452384 CCTTTCCCCTGGATGCAGGAAGG - Intergenic
952604261 3:35125176-35125198 CCATCCCCATGGAAGAAGAGGGG + Intergenic
952608887 3:35182995-35183017 CCTACTCCATGAAGGCAGGAAGG + Intergenic
954224271 3:49172407-49172429 CCTTTCCCATGGAGGCATGAAGG - Intronic
954633165 3:52057651-52057673 CTTTCCCTACGGAGCCAGGGTGG + Intergenic
955345911 3:58161758-58161780 CCTTCCTCTTGGTGGCAGGATGG + Intronic
955345917 3:58161781-58161803 CCTTCCTCTTGGTGGCAGGATGG + Intronic
955495624 3:59529148-59529170 CCTTGTACATGGAGGGAGGGAGG - Intergenic
956239512 3:67114007-67114029 CCTTCCACTAGGGGGCAGGGTGG + Intergenic
956659003 3:71581735-71581757 TCTTCCCCGTGCAGGCTGGGGGG + Intronic
956701764 3:71965163-71965185 CCCTCCCCATGGAGGATGGAAGG - Intergenic
956849142 3:73212350-73212372 TCTTCCACATGGTGGCAGGAAGG + Intergenic
959442323 3:106392490-106392512 CCCTCCCCATGGTGGGGGGGTGG - Intergenic
960440013 3:117675269-117675291 CCTCCCCCATGGAGGCAACTGGG - Intergenic
961216732 3:125165607-125165629 TGTTCCCCATGGGGGCATGGAGG + Intronic
968609609 4:1551082-1551104 CCTTCCCCCTGGAGACGGGGTGG - Intergenic
969058451 4:4416423-4416445 GATTCCCCATGGGGGCTGGGTGG + Intronic
969095915 4:4732700-4732722 CCATTCCCATGGGGGCATGGTGG + Intergenic
969430023 4:7148612-7148634 CATTCCCCATGGAAGCTGTGAGG - Intergenic
969684864 4:8665709-8665731 CTGTCCCCAGGGAGGGAGGGAGG + Intergenic
971853095 4:32009985-32010007 CCCTCCCCAGGGAGGCAGTGAGG + Intergenic
973646540 4:52956255-52956277 CCTTCCCCTTGGAGCCTGGAAGG + Intronic
974808954 4:66920912-66920934 CCTGTCCCATGGAGGAAGGAGGG - Intergenic
978323037 4:107519229-107519251 CCTCCCACAGGGAGGCAGTGTGG - Intergenic
978398232 4:108305284-108305306 CCTCCTTCAGGGAGGCAGGGAGG + Intergenic
979879080 4:125931301-125931323 CTCTTCCCATGGGGGCAGGGGGG - Intergenic
984940010 4:184922679-184922701 CCTTACCCAGGGAAGCAGAGTGG + Intergenic
984973216 4:185209146-185209168 CCTTCCCTAAGGCGGCAGGGTGG + Intronic
985129642 4:186726713-186726735 CCTCCCCCTTGGAGGCGGTGGGG + Intronic
985401828 4:189600709-189600731 CCATCCCCATGGTAGCTGGGTGG + Intergenic
985935073 5:3091297-3091319 TCTTTTCCATGGAGGAAGGGAGG - Intergenic
986876028 5:12110992-12111014 ACTTCCCCAGAGAGGCAGGGAGG + Intergenic
987129848 5:14850227-14850249 CCTTCCCCACCCAGGCAGTGGGG - Intronic
987160793 5:15140097-15140119 CTTTCCCCCAGGAGGGAGGGAGG + Intergenic
988096176 5:26613382-26613404 CCATCCCCATGGAGACACAGAGG - Intergenic
988126727 5:27049128-27049150 CCTTCTCCCTGGAGGCATGGAGG + Intronic
988672788 5:33399972-33399994 ACTTCTGTATGGAGGCAGGGAGG - Intergenic
989149409 5:38283712-38283734 CCTATCCCATGGAGTCAGAGAGG - Intronic
990976302 5:61564683-61564705 CCTCTCACATGGAGGCATGGGGG - Intergenic
996390023 5:122950460-122950482 CCTGCACCATGGAAGCAGAGAGG - Intronic
996551889 5:124739475-124739497 TTTTCCCCCTGGAGGCAAGGAGG - Intronic
998071126 5:139198521-139198543 CCCTCCCCTTGGGGGGAGGGAGG + Intronic
999140019 5:149354736-149354758 ACTTCAACACGGAGGCAGGGTGG - Intergenic
999719970 5:154392281-154392303 CATGCTCCCTGGAGGCAGGGAGG + Intronic
1001019268 5:168169337-168169359 CCTTGCAGATGGAGGTAGGGTGG - Intronic
1002570203 5:180135845-180135867 GCTTACCCGTGGAGGCAGAGAGG + Intronic
1005355691 6:24981251-24981273 CCTTCCCCATAGAGCCATAGTGG + Intronic
1005609127 6:27506560-27506582 CCTTCCCCAGGGAGGGAAGCAGG + Intergenic
1006273351 6:32981123-32981145 CCCTCCCCATGGAGGCTGAGGGG - Exonic
1007350389 6:41269195-41269217 ACCTCCCCATGTAGGCAGGAAGG + Intronic
1007361347 6:41358614-41358636 CCTTCCCCTTCCAGCCAGGGTGG + Intergenic
1011014309 6:82737745-82737767 GCTGCCACATGGTGGCAGGGGGG - Intergenic
1012949871 6:105506445-105506467 CCTTGCCTCTGGAGGCAAGGCGG + Intergenic
1013467635 6:110431129-110431151 CCCTCCCCAAGGGGGCACGGAGG - Intronic
1014125278 6:117769977-117769999 CCTTCATCTTGGAGACAGGGAGG + Intergenic
1017906939 6:158763163-158763185 CCCTCCCCAGTGAAGCAGGGTGG - Intronic
1018090694 6:160345241-160345263 GCTGCCCCAAGGAGGAAGGGAGG + Intergenic
1018645537 6:165944394-165944416 CCTTCCTCTTGCAGACAGGGAGG + Intronic
1018787673 6:167121085-167121107 CCTTCCCCTCTGGGGCAGGGAGG + Intergenic
1018940962 6:168308648-168308670 CCATCTCCACAGAGGCAGGGTGG - Exonic
1020376944 7:7498441-7498463 ACTTACCCTTGGAGGCTGGGAGG + Intronic
1022221871 7:28321669-28321691 CCCATCCCAGGGAGGCAGGGAGG + Intronic
1022467889 7:30663634-30663656 CCTTCCCAAAGGAGGCAGGGAGG + Intronic
1022801740 7:33783210-33783232 CCCTACCAATGCAGGCAGGGAGG + Intergenic
1023166859 7:37351449-37351471 CTTTCCCCATGGAGGGAGCATGG - Intronic
1024027936 7:45430111-45430133 CCTTCCCCAAGGTGAGAGGGTGG - Intergenic
1027309765 7:76943152-76943174 CCTTGCCCTTGGAGGCAGGAGGG - Intergenic
1027632194 7:80620622-80620644 CCTTCCCCCAGGATGTAGGGTGG + Intronic
1034473819 7:151271139-151271161 CCTCCCACAGGGAGGAAGGGTGG - Intronic
1035819034 8:2571865-2571887 CCTCCCCGATGGAGGCGGCGCGG - Intergenic
1037513066 8:19603215-19603237 CCATCCCCATGGAGGAACTGGGG - Intronic
1037789321 8:21922451-21922473 CTTTCACCCTGAAGGCAGGGTGG + Intronic
1038328491 8:26589920-26589942 GCCTCCCCATGGAGGCAGGAGGG + Intronic
1038389313 8:27180341-27180363 CCTTCCAAATGGAGGCACAGTGG + Intergenic
1038822596 8:30966345-30966367 CCATCCCCAAGCAGGGAGGGAGG + Intergenic
1039364745 8:36917918-36917940 CCTTCCATATGGAGACAGGCAGG + Intronic
1039816659 8:41100523-41100545 CCTTTCCCAGGGAGGCTGGGTGG + Intergenic
1042765273 8:72314397-72314419 CCTGCCACCTGGAGGCAGGCTGG + Intergenic
1043438096 8:80253623-80253645 CCTGCCCCTTGGAGGGAGGGTGG - Intergenic
1043734815 8:83729828-83729850 CCTTCCCCTATGAAGCAGGGAGG + Intergenic
1045038817 8:98201194-98201216 GCTTTCTCATGGAGGCAGAGAGG + Intronic
1045666582 8:104493817-104493839 CTTTCCCCATAGAGGCAGGAGGG - Intronic
1048931461 8:139318812-139318834 ACGTCTCCATGGAGGCAGTGAGG - Intergenic
1049372111 8:142272872-142272894 CCTTCCCCACGGTGTCAGGAGGG - Intronic
1049561076 8:143310587-143310609 CTTTCCCTAAGGAGGCAGGAAGG - Intronic
1049611362 8:143557278-143557300 CCTTCGCCATAGCGGCAAGGTGG - Intronic
1049685573 8:143938007-143938029 CCTTCTCCCTGGGGGCAGGCTGG - Intronic
1049852961 8:144843968-144843990 CCTTCCTCAGAGAGGCAGGCTGG + Intronic
1052817438 9:33112316-33112338 CCCTCCCCAGGTGGGCAGGGCGG - Exonic
1053229373 9:36393588-36393610 CCTTCCCCATGTGCGCAGGCAGG + Intronic
1053450754 9:38192263-38192285 CCTCCTCCATGCAGGCATGGAGG + Intergenic
1056194728 9:84218404-84218426 CCTTCCCCAGGGAGGAAAGGAGG - Intergenic
1056722418 9:89083119-89083141 CCTTCCCCATGGAGGCAGGGTGG - Intronic
1057128563 9:92637967-92637989 CCTTCCCCAGGTAGGCGGTGGGG - Intronic
1057162152 9:92896342-92896364 CCCTACAGATGGAGGCAGGGAGG + Intergenic
1057295264 9:93830882-93830904 ACTTCCACATCGAGGGAGGGAGG - Intergenic
1057501570 9:95600826-95600848 CCTTCCCCAAAGGGTCAGGGAGG + Intergenic
1058529205 9:105889236-105889258 CCATCCCCATGGAGGCTGGGAGG + Intergenic
1058643801 9:107111899-107111921 CCATCACCATTTAGGCAGGGAGG - Intergenic
1058820207 9:108722719-108722741 CCTGCTCCATGGAGACAGAGTGG - Intergenic
1058881786 9:109291763-109291785 CCTTGCCCATGGAGTGAGGAGGG - Intronic
1059427338 9:114229397-114229419 CCTTCCTCCAGGAGCCAGGGAGG + Intronic
1060968327 9:127723997-127724019 CCTGACCCATGGAGGCAGTGGGG - Intronic
1061753797 9:132798888-132798910 CCTTCCCCTTCGAGACAGGAGGG - Intronic
1062631481 9:137464999-137465021 CCTTCCTCAGTGAGGCAGGCAGG + Intronic
1185611573 X:1396485-1396507 CCTTTCCCAAGGAGGCTGTGTGG - Intergenic
1185677603 X:1861356-1861378 CCTTCCCCTTGGACTCAGTGTGG + Intergenic
1186522572 X:10219358-10219380 CCTTACCCACTAAGGCAGGGAGG - Intronic
1190115025 X:47620524-47620546 CCTTGCCCAAGGTGGCAAGGGGG + Intergenic
1192147347 X:68690416-68690438 CCATTCCCAGGCAGGCAGGGCGG + Intronic
1192221287 X:69198945-69198967 CCTAGCCCATTGAGGCAGGGAGG + Intergenic
1193152520 X:78139823-78139845 CCTTCCCCATGGAGCCTGCTGGG + Intergenic
1200182338 X:154158384-154158406 GGTTCCCTATGGAGGCCGGGAGG + Intronic
1200187992 X:154195498-154195520 GGTTCCCTATGGAGGCCGGGAGG + Intergenic
1200193642 X:154232638-154232660 GGTTCCCTATGGAGGCCGGGAGG + Intronic
1200199397 X:154270442-154270464 GGTTCCCTATGGAGGCCGGGAGG + Intronic
1202137112 Y:21676920-21676942 CATTGCCCAGGGCGGCAGGGCGG + Intergenic