ID: 1056727889

View in Genome Browser
Species Human (GRCh38)
Location 9:89138090-89138112
Sequence TGCCAGCTACAGAGACTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056727882_1056727889 0 Left 1056727882 9:89138067-89138089 CCTTGCCCTGGGAAGCCGTGAGC 0: 1
1: 0
2: 0
3: 36
4: 390
Right 1056727889 9:89138090-89138112 TGCCAGCTACAGAGACTTGGGGG No data
1056727884_1056727889 -6 Left 1056727884 9:89138073-89138095 CCTGGGAAGCCGTGAGCTGCCAG 0: 1
1: 0
2: 2
3: 14
4: 240
Right 1056727889 9:89138090-89138112 TGCCAGCTACAGAGACTTGGGGG No data
1056727878_1056727889 26 Left 1056727878 9:89138041-89138063 CCCTTTGTAGACTCTGATGCTTC 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1056727889 9:89138090-89138112 TGCCAGCTACAGAGACTTGGGGG No data
1056727883_1056727889 -5 Left 1056727883 9:89138072-89138094 CCCTGGGAAGCCGTGAGCTGCCA 0: 1
1: 1
2: 2
3: 17
4: 219
Right 1056727889 9:89138090-89138112 TGCCAGCTACAGAGACTTGGGGG No data
1056727879_1056727889 25 Left 1056727879 9:89138042-89138064 CCTTTGTAGACTCTGATGCTTCT 0: 1
1: 0
2: 2
3: 13
4: 196
Right 1056727889 9:89138090-89138112 TGCCAGCTACAGAGACTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056727889 Original CRISPR TGCCAGCTACAGAGACTTGG GGG Intronic
No off target data available for this crispr