ID: 1056729970

View in Genome Browser
Species Human (GRCh38)
Location 9:89157023-89157045
Sequence GTTTAAGCCATCTGGGAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056729961_1056729970 -1 Left 1056729961 9:89157001-89157023 CCCTGCCTCCATAAACCCTTACG No data
Right 1056729970 9:89157023-89157045 GTTTAAGCCATCTGGGAGGTCGG No data
1056729958_1056729970 20 Left 1056729958 9:89156980-89157002 CCTTGCCTATAACTTATGCCTCC No data
Right 1056729970 9:89157023-89157045 GTTTAAGCCATCTGGGAGGTCGG No data
1056729960_1056729970 2 Left 1056729960 9:89156998-89157020 CCTCCCTGCCTCCATAAACCCTT No data
Right 1056729970 9:89157023-89157045 GTTTAAGCCATCTGGGAGGTCGG No data
1056729964_1056729970 -9 Left 1056729964 9:89157009-89157031 CCATAAACCCTTACGTTTAAGCC No data
Right 1056729970 9:89157023-89157045 GTTTAAGCCATCTGGGAGGTCGG No data
1056729959_1056729970 15 Left 1056729959 9:89156985-89157007 CCTATAACTTATGCCTCCCTGCC No data
Right 1056729970 9:89157023-89157045 GTTTAAGCCATCTGGGAGGTCGG No data
1056729962_1056729970 -2 Left 1056729962 9:89157002-89157024 CCTGCCTCCATAAACCCTTACGT No data
Right 1056729970 9:89157023-89157045 GTTTAAGCCATCTGGGAGGTCGG No data
1056729963_1056729970 -6 Left 1056729963 9:89157006-89157028 CCTCCATAAACCCTTACGTTTAA No data
Right 1056729970 9:89157023-89157045 GTTTAAGCCATCTGGGAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056729970 Original CRISPR GTTTAAGCCATCTGGGAGGT CGG Intronic