ID: 1056732491

View in Genome Browser
Species Human (GRCh38)
Location 9:89178169-89178191
Sequence GCGGGCGGGCGCGCGGCTCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 303}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056732491_1056732503 4 Left 1056732491 9:89178169-89178191 CCGAGAGCCGCGCGCCCGCCCGC 0: 1
1: 0
2: 3
3: 46
4: 303
Right 1056732503 9:89178196-89178218 GGGCGGCCGACGACAGGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 93
1056732491_1056732508 28 Left 1056732491 9:89178169-89178191 CCGAGAGCCGCGCGCCCGCCCGC 0: 1
1: 0
2: 3
3: 46
4: 303
Right 1056732508 9:89178220-89178242 GGCCCGAGCTGGAGAGTTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 101
1056732491_1056732506 17 Left 1056732491 9:89178169-89178191 CCGAGAGCCGCGCGCCCGCCCGC 0: 1
1: 0
2: 3
3: 46
4: 303
Right 1056732506 9:89178209-89178231 CAGGCCGCGGAGGCCCGAGCTGG 0: 1
1: 0
2: 2
3: 48
4: 228
1056732491_1056732504 7 Left 1056732491 9:89178169-89178191 CCGAGAGCCGCGCGCCCGCCCGC 0: 1
1: 0
2: 3
3: 46
4: 303
Right 1056732504 9:89178199-89178221 CGGCCGACGACAGGCCGCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 68
1056732491_1056732500 -2 Left 1056732491 9:89178169-89178191 CCGAGAGCCGCGCGCCCGCCCGC 0: 1
1: 0
2: 3
3: 46
4: 303
Right 1056732500 9:89178190-89178212 GCTCCCGGGCGGCCGACGACAGG 0: 1
1: 0
2: 0
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056732491 Original CRISPR GCGGGCGGGCGCGCGGCTCT CGG (reversed) Exonic