ID: 1056733749

View in Genome Browser
Species Human (GRCh38)
Location 9:89186595-89186617
Sequence GCACTGGGTCAGGCTGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056733749_1056733757 4 Left 1056733749 9:89186595-89186617 CCAAAGCCAGCCTGACCCAGTGC No data
Right 1056733757 9:89186622-89186644 ACAAAAATAACACACAAAGAGGG No data
1056733749_1056733756 3 Left 1056733749 9:89186595-89186617 CCAAAGCCAGCCTGACCCAGTGC No data
Right 1056733756 9:89186621-89186643 CACAAAAATAACACACAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056733749 Original CRISPR GCACTGGGTCAGGCTGGCTT TGG (reversed) Intergenic
No off target data available for this crispr