ID: 1056734531 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:89196732-89196754 |
Sequence | CAATTTTGGCAGAAGGTGAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1056734527_1056734531 | -9 | Left | 1056734527 | 9:89196718-89196740 | CCTCAGAAAACTTGCAATTTTGG | No data | ||
Right | 1056734531 | 9:89196732-89196754 | CAATTTTGGCAGAAGGTGAAGGG | No data | ||||
1056734525_1056734531 | 30 | Left | 1056734525 | 9:89196679-89196701 | CCATACAGGAAGCATGAGGCAGG | No data | ||
Right | 1056734531 | 9:89196732-89196754 | CAATTTTGGCAGAAGGTGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1056734531 | Original CRISPR | CAATTTTGGCAGAAGGTGAA GGG | Intergenic | ||
No off target data available for this crispr |