ID: 1056734531

View in Genome Browser
Species Human (GRCh38)
Location 9:89196732-89196754
Sequence CAATTTTGGCAGAAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056734527_1056734531 -9 Left 1056734527 9:89196718-89196740 CCTCAGAAAACTTGCAATTTTGG No data
Right 1056734531 9:89196732-89196754 CAATTTTGGCAGAAGGTGAAGGG No data
1056734525_1056734531 30 Left 1056734525 9:89196679-89196701 CCATACAGGAAGCATGAGGCAGG No data
Right 1056734531 9:89196732-89196754 CAATTTTGGCAGAAGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056734531 Original CRISPR CAATTTTGGCAGAAGGTGAA GGG Intergenic
No off target data available for this crispr