ID: 1056746840

View in Genome Browser
Species Human (GRCh38)
Location 9:89310763-89310785
Sequence CTGTCGACCTTGCACGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056746840_1056746844 11 Left 1056746840 9:89310763-89310785 CCATCACCGTGCAAGGTCGACAG No data
Right 1056746844 9:89310797-89310819 AGCCCTGTGGCCCACGCTTCCGG No data
1056746840_1056746842 -2 Left 1056746840 9:89310763-89310785 CCATCACCGTGCAAGGTCGACAG No data
Right 1056746842 9:89310784-89310806 AGCTTCCGCTCAAAGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056746840 Original CRISPR CTGTCGACCTTGCACGGTGA TGG (reversed) Intergenic
No off target data available for this crispr