ID: 1056746960

View in Genome Browser
Species Human (GRCh38)
Location 9:89311386-89311408
Sequence TCAGCCGGGGCCCCCGCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056746946_1056746960 14 Left 1056746946 9:89311349-89311371 CCGGTGGGCGCCTTTCTTAGACC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1056746960 9:89311386-89311408 TCAGCCGGGGCCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 128
1056746952_1056746960 -9 Left 1056746952 9:89311372-89311394 CCGAGCCGGCTCCCTCAGCCGGG 0: 1
1: 0
2: 3
3: 41
4: 204
Right 1056746960 9:89311386-89311408 TCAGCCGGGGCCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 128
1056746949_1056746960 -7 Left 1056746949 9:89311370-89311392 CCCCGAGCCGGCTCCCTCAGCCG 0: 1
1: 0
2: 1
3: 10
4: 124
Right 1056746960 9:89311386-89311408 TCAGCCGGGGCCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 128
1056746950_1056746960 -8 Left 1056746950 9:89311371-89311393 CCCGAGCCGGCTCCCTCAGCCGG 0: 1
1: 26
2: 505
3: 592
4: 648
Right 1056746960 9:89311386-89311408 TCAGCCGGGGCCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 128
1056746948_1056746960 4 Left 1056746948 9:89311359-89311381 CCTTTCTTAGACCCCGAGCCGGC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1056746960 9:89311386-89311408 TCAGCCGGGGCCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056746960 Original CRISPR TCAGCCGGGGCCCCCGCGGG CGG Intronic