ID: 1056746960

View in Genome Browser
Species Human (GRCh38)
Location 9:89311386-89311408
Sequence TCAGCCGGGGCCCCCGCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056746946_1056746960 14 Left 1056746946 9:89311349-89311371 CCGGTGGGCGCCTTTCTTAGACC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1056746960 9:89311386-89311408 TCAGCCGGGGCCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 128
1056746948_1056746960 4 Left 1056746948 9:89311359-89311381 CCTTTCTTAGACCCCGAGCCGGC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1056746960 9:89311386-89311408 TCAGCCGGGGCCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 128
1056746949_1056746960 -7 Left 1056746949 9:89311370-89311392 CCCCGAGCCGGCTCCCTCAGCCG 0: 1
1: 0
2: 1
3: 10
4: 124
Right 1056746960 9:89311386-89311408 TCAGCCGGGGCCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 128
1056746950_1056746960 -8 Left 1056746950 9:89311371-89311393 CCCGAGCCGGCTCCCTCAGCCGG 0: 1
1: 26
2: 505
3: 592
4: 648
Right 1056746960 9:89311386-89311408 TCAGCCGGGGCCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 128
1056746952_1056746960 -9 Left 1056746952 9:89311372-89311394 CCGAGCCGGCTCCCTCAGCCGGG 0: 1
1: 0
2: 3
3: 41
4: 204
Right 1056746960 9:89311386-89311408 TCAGCCGGGGCCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056746960 Original CRISPR TCAGCCGGGGCCCCCGCGGG CGG Intronic
900171917 1:1273521-1273543 TCGGGCCGGGGCCCCGCGGGCGG + Intronic
900326327 1:2110309-2110331 ACGCCCGGGGCCCCCGCTGGAGG - Intronic
901234768 1:7661868-7661890 TGAGCCGGGGCTCCCGGGGCAGG + Intronic
901835224 1:11919796-11919818 TGGGCCGGGGCCCCCCAGGGTGG - Exonic
902911023 1:19597247-19597269 GCCGCCCGGGCCCCGGCGGGAGG + Intronic
904211211 1:28887735-28887757 ACAGCCGGCGCCCCAGCTGGCGG - Intronic
914755469 1:150559498-150559520 TCAGCCTGGGCCCCTAGGGGAGG + Intronic
915070371 1:153261236-153261258 ACAGCCAGAGCCCCCGCCGGAGG - Exonic
915459437 1:156061046-156061068 TCAGCCTGGGCTCCCGCAAGCGG - Intergenic
915463185 1:156081727-156081749 GCGGCCGGGGGCGCCGCGGGCGG + Exonic
924732402 1:246724226-246724248 TCACCCGCGGCTCCCGCGCGAGG + Exonic
1063115585 10:3069147-3069169 CCACCCGGGTCTCCCGCGGGGGG - Intronic
1064230769 10:13528399-13528421 CCAGCGTGGACCCCCGCGGGCGG + Intronic
1064553000 10:16521264-16521286 CCAGCCGCAGCCTCCGCGGGGGG - Exonic
1065687684 10:28302692-28302714 TCAGCCTGGGAGCCCGCGGCGGG - Intronic
1074130388 10:110568163-110568185 CCCGCCGGGGCGGCCGCGGGCGG + Intronic
1076178789 10:128389465-128389487 ACAGCCGAGGCCCCCATGGGAGG + Intergenic
1076543762 10:131230419-131230441 TCAGCCGGTGCCCTCTGGGGTGG - Intronic
1076859060 10:133131579-133131601 TCAGCCGGGGGCACTGAGGGTGG - Exonic
1076864551 10:133160426-133160448 CCAGCCGGAGGCCCCGGGGGCGG + Exonic
1077225635 11:1437987-1438009 TCAGCTGGGGCCCTGGCTGGTGG - Intronic
1080628541 11:34052219-34052241 CCAGCCGGGCGCCCCGCTGGCGG + Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1083894383 11:65612893-65612915 TCAGCTGGGACCCCCTAGGGTGG + Intronic
1085318772 11:75562032-75562054 GCAGCCCGGGCCGCCGAGGGAGG + Intergenic
1089527587 11:119107438-119107460 TCCGGCGGGGCCCGCGCGGTGGG + Exonic
1091274740 11:134342565-134342587 TCAGCACGGGGCCCCGCGGCAGG - Intronic
1100330181 12:93573813-93573835 TCTGCCGGTGCCTCCCCGGGAGG - Intronic
1104865275 12:131949941-131949963 GCATCCGGGGCCCCGGCGGGAGG - Intronic
1106246388 13:27953896-27953918 GCAGCCGGAGCCGCCGCAGGAGG - Intergenic
1112508443 13:99989259-99989281 GCAGCTGGAGCCCCCTCGGGAGG + Intergenic
1113558553 13:111258082-111258104 TCAGCCGGGGCAGCCAAGGGAGG + Intronic
1118285603 14:64468604-64468626 TCAGCCAGAGCCCACACGGGGGG + Exonic
1118313117 14:64707168-64707190 GCTGCCAGGGCCCCCGCTGGAGG - Intronic
1119325601 14:73758374-73758396 TCAGCTGAGGCCCCCTAGGGAGG + Intronic
1122874660 14:104658411-104658433 TCAGCCGGGGTGCCCGAGTGGGG - Intergenic
1122920909 14:104879748-104879770 ACAGCCGGGGCCCCTGTGGGGGG + Intronic
1122982689 14:105198755-105198777 TCACCCTGGGCCCCTGCTGGTGG + Intergenic
1124250961 15:28106466-28106488 CCAGCCCGGGAGCCCGCGGGTGG - Intergenic
1125033066 15:35092455-35092477 TCAGCAGGGGCGGCGGCGGGTGG + Intergenic
1127458682 15:59178339-59178361 GCTGGCGGGGGCCCCGCGGGAGG + Intronic
1128742874 15:70095943-70095965 TCATTCGGGGACCCCACGGGCGG + Intronic
1129440748 15:75579279-75579301 TCAGCCAGGCTCCTCGCGGGCGG + Exonic
1131214985 15:90529529-90529551 TCACCTCGGGCCCCCGCAGGGGG - Intergenic
1131617684 15:94033858-94033880 TCAGCCGGCGCCCCAGCCTGCGG + Intergenic
1132544777 16:528062-528084 CCAGCCGGGGACCCCGGGCGGGG + Intronic
1132645447 16:997363-997385 TCTCCCTGGGCCCCCGAGGGAGG + Intergenic
1132663001 16:1069865-1069887 TCAGCCAGGGCCCCAGGGGCGGG + Intergenic
1132747128 16:1441490-1441512 TCAGCAGGGGCCTCCGCTGTGGG - Intronic
1132876887 16:2143956-2143978 CAAGCCGGGGACCCCGCGGAGGG + Intronic
1134519352 16:14911620-14911642 TGAGCCGCGGCCTCCGCGCGCGG + Intronic
1134554581 16:15154608-15154630 TGAGCCGCGGCCTCCGCGCGCGG - Intergenic
1134707022 16:16310275-16310297 TGAGCCGCGGCCTCCGCGCGCGG + Intergenic
1134960518 16:18401849-18401871 TGAGCCGCGGCCTCCGCGCGCGG - Intergenic
1136365369 16:29806904-29806926 CCAGCCCGGGCCGCCGCGGCCGG - Intronic
1136478292 16:30526538-30526560 CCAGCCCGGGCCCCCGAGGCCGG + Exonic
1138539824 16:57681019-57681041 GCAGCCAGGGCCCCTGAGGGTGG - Intronic
1139958512 16:70704724-70704746 ACAGCCGGAGCCCGCTCGGGAGG + Intronic
1143590628 17:7884599-7884621 TCAGACGGCGGCCCCGAGGGTGG + Intronic
1144465383 17:15492987-15493009 GCTGCCAGGGCCACCGCGGGGGG + Intronic
1147425814 17:40345409-40345431 TCAGCCGGGCCCCCGGCCAGCGG - Intronic
1147426619 17:40348804-40348826 TCAGGCAGGGCCGCCGGGGGAGG - Intronic
1149678497 17:58487733-58487755 TCGGGCCGGGGCCCCGCGGGCGG + Exonic
1152161876 17:78673998-78674020 TCAGGCGGGGCCCTCGAGGTGGG - Intergenic
1152284833 17:79406326-79406348 TCACCCGTGGCTCCCGCTGGGGG + Intronic
1152321376 17:79610329-79610351 GCAGCCGGAGCCCGCGCGGGTGG - Intergenic
1152759106 17:82098951-82098973 CCGGCCGGGGCGCCCGCGGCCGG - Intergenic
1152845286 17:82596042-82596064 ACAGCCGGGGCCACTGCGGTAGG - Intronic
1159946291 18:74446939-74446961 GCAGGCGGGGCCCACGCTGGCGG - Exonic
1160910007 19:1469941-1469963 CCCCCCGGGGCCCCCGCCGGCGG + Exonic
1161208303 19:3053668-3053690 TGGGCTGGGGCCCCCGCCGGCGG + Exonic
1161925261 19:7294527-7294549 TGTGCCGGGCCCCGCGCGGGAGG + Intergenic
1162935359 19:13979108-13979130 TCAACGGGGGCGGCCGCGGGCGG + Intronic
1164647765 19:29872328-29872350 TCAGCGAAGGCACCCGCGGGCGG - Intergenic
1165718666 19:38063415-38063437 TCAGCCCGGCCCCCAGCGGCAGG + Intronic
1166380358 19:42352361-42352383 TCAGGCAGGTCGCCCGCGGGTGG - Exonic
1167502772 19:49856956-49856978 TGACCCGCGGCCCCCGCAGGCGG + Exonic
1167590490 19:50402050-50402072 TCAGCCGGGACAGTCGCGGGGGG + Exonic
926268296 2:11345031-11345053 TCAGCGGGGGCCGCGGCGGGGGG - Intronic
929756310 2:44768545-44768567 TGAGCCGGGGGCCACGCTGGAGG + Intronic
931253759 2:60553815-60553837 CCAGACGCGGCCCCCGGGGGAGG + Intergenic
931869637 2:66444647-66444669 CCAGCCTTGGCCCCCGCGGGCGG + Intronic
932573618 2:72951025-72951047 TCAACAGGGGCTCCCGAGGGAGG + Intronic
937994132 2:127680173-127680195 ACAGCCGGAGCCCTCCCGGGCGG + Intronic
938093394 2:128447474-128447496 CCAGCCATGGCCCCCGTGGGTGG + Intergenic
944585162 2:201166399-201166421 TCAGACGGGGCAGCTGCGGGCGG + Exonic
945080934 2:206085683-206085705 GCCTCCGGGGCGCCCGCGGGCGG - Intronic
946416385 2:219542068-219542090 CCAGCCGGTGCCCCAGCGTGCGG + Exonic
948465656 2:238150519-238150541 TCAGCCCGGACCTCCCCGGGAGG + Intronic
948801464 2:240435395-240435417 GCGGCCGGGGTCCCCGAGGGCGG - Intergenic
1169113197 20:3046201-3046223 TCCGCAGGGTCCACCGCGGGCGG - Exonic
1172277208 20:33686236-33686258 TTGGCCGGGGCCCCTGCGGGCGG - Exonic
1172468521 20:35174661-35174683 TCAGCCTGGGCCGGCGTGGGAGG - Intronic
1175253278 20:57622591-57622613 TCAGCCGGAGCCCCTTCCGGAGG - Intergenic
1175924758 20:62466245-62466267 ATAGCCCGGGCCCCCGGGGGTGG + Intronic
1176190746 20:63808463-63808485 TCAGCCCCGGGCCCGGCGGGAGG + Intronic
1176298837 21:5088896-5088918 TCAGCCGTGGCCCCCGCCTCGGG - Intergenic
1179858189 21:44173053-44173075 TCAGCCGTGGCCCCCGCCTCGGG + Intergenic
1180132331 21:45834720-45834742 TCAGAGGGGGCCCACGAGGGAGG + Intronic
1180875058 22:19171352-19171374 CCAGCGGGGGCCCACGCTGGAGG - Intergenic
1183282126 22:36937629-36937651 CCAGCCGGAGCCCCCACAGGAGG + Exonic
953925941 3:46982442-46982464 TGAGCCGGGCCCCCAGGGGGAGG - Intronic
960586122 3:119322870-119322892 GCACCCGGGACCCCCGCGGCCGG - Intronic
963213954 3:142724295-142724317 TCGGCCGGGGCGCCGGCGGCTGG + Exonic
969239257 4:5888413-5888435 GCAGCCGGGGCAGCCGCGCGTGG - Intronic
972476922 4:39459144-39459166 TCACCCGGGGCCCCAGGGTGCGG - Exonic
985513143 5:323097-323119 TCAGCCGGGGACCACGGGTGGGG - Intronic
985565133 5:611882-611904 TCTGGAGGGGTCCCCGCGGGGGG + Intergenic
985844674 5:2335325-2335347 TGAGGCGTGGGCCCCGCGGGGGG - Intergenic
990954918 5:61331917-61331939 TCAGGCGGGGTTCCCGTGGGAGG - Intergenic
992515877 5:77492067-77492089 TCCGCCCGGGTCCCCGCGGTCGG + Intronic
997086152 5:130802002-130802024 TCAGCCTGGGCCCCAGAGTGAGG + Intergenic
999300354 5:150486550-150486572 TCGGCCGGGCCCCGCGCGCGGGG + Intronic
999722577 5:154409727-154409749 GCAGCCGGGGGCTCCACGGGTGG - Exonic
1002645003 5:180648772-180648794 GGAGCAGAGGCCCCCGCGGGAGG - Intronic
1006665111 6:35688347-35688369 TCAGCCGGCACCGCTGCGGGCGG - Intronic
1020133078 7:5570355-5570377 TGAGCCGCGGCCGCCACGGGGGG + Intergenic
1024023615 7:45392207-45392229 ACAGATGGGGCCCCCGCTGGGGG + Intergenic
1031011173 7:116526199-116526221 TGAGCCGGGGCGTGCGCGGGCGG + Intronic
1032408099 7:131672314-131672336 TCAGCCTGTGTCCCCGCGTGAGG + Intergenic
1034307899 7:150060723-150060745 TCAGCCCGGGCTCCCGGGGCTGG - Intergenic
1034758436 7:153646520-153646542 TCAGCCTGGGCCCCTGAGGGAGG - Intergenic
1034798954 7:154039946-154039968 TCAGCCCGGGCTCCCGGGGCTGG + Intronic
1037503303 8:19505875-19505897 AAAGCCGGGGCCCCCACGGAAGG + Exonic
1038488556 8:27953317-27953339 TTAGCTGGGGCCCCAGTGGGTGG - Intronic
1039393521 8:37202591-37202613 TCAGCAGCAGCCCCCACGGGTGG - Intergenic
1045673957 8:104588566-104588588 TCCGCCGGGGCCCTCCCGGCCGG + Intronic
1049989393 9:977280-977302 TCTGCCAGGGCCCCCGCCGCCGG + Exonic
1056746960 9:89311386-89311408 TCAGCCGGGGCCCCCGCGGGCGG + Intronic
1060549378 9:124477817-124477839 GCAGCCGCGGCGCCCGCGGGTGG - Intronic
1061208505 9:129177607-129177629 GCGGCCGGAGCGCCCGCGGGCGG - Exonic
1061800828 9:133112676-133112698 TCAGCCAGGGCCCCCCAGGCTGG - Intronic
1062559880 9:137136773-137136795 ACAGCTGCGGCCCCGGCGGGAGG - Intergenic
1196871244 X:120115604-120115626 GCAGCCGCAGCCCCCGCCGGAGG - Exonic
1200128914 X:153830655-153830677 GCAGCGGCGGGCCCCGCGGGCGG - Intergenic
1201766124 Y:17574995-17575017 TCAACCAGGGCCCCTGGGGGGGG + Intergenic
1201835428 Y:18330994-18331016 TCAACCAGGGCCCCTGGGGGGGG - Intergenic