ID: 1056747733

View in Genome Browser
Species Human (GRCh38)
Location 9:89318741-89318763
Sequence AAGATCGCGGCCACCCGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 9}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056747733_1056747738 -7 Left 1056747733 9:89318741-89318763 CCCTACCGGGTGGCCGCGATCTT 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1056747738 9:89318757-89318779 CGATCTTCGCGCCCCGCCTCGGG 0: 1
1: 0
2: 0
3: 1
4: 41
1056747733_1056747739 3 Left 1056747733 9:89318741-89318763 CCCTACCGGGTGGCCGCGATCTT 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1056747739 9:89318767-89318789 GCCCCGCCTCGGGTCCGCCTTGG 0: 1
1: 0
2: 3
3: 23
4: 127
1056747733_1056747743 5 Left 1056747733 9:89318741-89318763 CCCTACCGGGTGGCCGCGATCTT 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1056747743 9:89318769-89318791 CCCGCCTCGGGTCCGCCTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 81
1056747733_1056747737 -8 Left 1056747733 9:89318741-89318763 CCCTACCGGGTGGCCGCGATCTT 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1056747737 9:89318756-89318778 GCGATCTTCGCGCCCCGCCTCGG 0: 1
1: 0
2: 0
3: 2
4: 31
1056747733_1056747741 4 Left 1056747733 9:89318741-89318763 CCCTACCGGGTGGCCGCGATCTT 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1056747741 9:89318768-89318790 CCCCGCCTCGGGTCCGCCTTGGG 0: 1
1: 0
2: 1
3: 4
4: 98
1056747733_1056747749 18 Left 1056747733 9:89318741-89318763 CCCTACCGGGTGGCCGCGATCTT 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1056747749 9:89318782-89318804 CGCCTTGGGGTGGCGGTCAGCGG 0: 1
1: 0
2: 0
3: 11
4: 136
1056747733_1056747745 8 Left 1056747733 9:89318741-89318763 CCCTACCGGGTGGCCGCGATCTT 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1056747745 9:89318772-89318794 GCCTCGGGTCCGCCTTGGGGTGG 0: 1
1: 0
2: 0
3: 9
4: 81
1056747733_1056747747 11 Left 1056747733 9:89318741-89318763 CCCTACCGGGTGGCCGCGATCTT 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1056747747 9:89318775-89318797 TCGGGTCCGCCTTGGGGTGGCGG 0: 1
1: 0
2: 1
3: 8
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056747733 Original CRISPR AAGATCGCGGCCACCCGGTA GGG (reversed) Intronic