ID: 1056747739

View in Genome Browser
Species Human (GRCh38)
Location 9:89318767-89318789
Sequence GCCCCGCCTCGGGTCCGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056747735_1056747739 -2 Left 1056747735 9:89318746-89318768 CCGGGTGGCCGCGATCTTCGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1056747739 9:89318767-89318789 GCCCCGCCTCGGGTCCGCCTTGG 0: 1
1: 0
2: 3
3: 23
4: 127
1056747736_1056747739 -10 Left 1056747736 9:89318754-89318776 CCGCGATCTTCGCGCCCCGCCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1056747739 9:89318767-89318789 GCCCCGCCTCGGGTCCGCCTTGG 0: 1
1: 0
2: 3
3: 23
4: 127
1056747734_1056747739 2 Left 1056747734 9:89318742-89318764 CCTACCGGGTGGCCGCGATCTTC 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1056747739 9:89318767-89318789 GCCCCGCCTCGGGTCCGCCTTGG 0: 1
1: 0
2: 3
3: 23
4: 127
1056747733_1056747739 3 Left 1056747733 9:89318741-89318763 CCCTACCGGGTGGCCGCGATCTT 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1056747739 9:89318767-89318789 GCCCCGCCTCGGGTCCGCCTTGG 0: 1
1: 0
2: 3
3: 23
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056747739 Original CRISPR GCCCCGCCTCGGGTCCGCCT TGG Intronic