ID: 1056747741

View in Genome Browser
Species Human (GRCh38)
Location 9:89318768-89318790
Sequence CCCCGCCTCGGGTCCGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056747734_1056747741 3 Left 1056747734 9:89318742-89318764 CCTACCGGGTGGCCGCGATCTTC 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1056747741 9:89318768-89318790 CCCCGCCTCGGGTCCGCCTTGGG 0: 1
1: 0
2: 1
3: 4
4: 98
1056747735_1056747741 -1 Left 1056747735 9:89318746-89318768 CCGGGTGGCCGCGATCTTCGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1056747741 9:89318768-89318790 CCCCGCCTCGGGTCCGCCTTGGG 0: 1
1: 0
2: 1
3: 4
4: 98
1056747733_1056747741 4 Left 1056747733 9:89318741-89318763 CCCTACCGGGTGGCCGCGATCTT 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1056747741 9:89318768-89318790 CCCCGCCTCGGGTCCGCCTTGGG 0: 1
1: 0
2: 1
3: 4
4: 98
1056747736_1056747741 -9 Left 1056747736 9:89318754-89318776 CCGCGATCTTCGCGCCCCGCCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1056747741 9:89318768-89318790 CCCCGCCTCGGGTCCGCCTTGGG 0: 1
1: 0
2: 1
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056747741 Original CRISPR CCCCGCCTCGGGTCCGCCTT GGG Intronic