ID: 1056747749

View in Genome Browser
Species Human (GRCh38)
Location 9:89318782-89318804
Sequence CGCCTTGGGGTGGCGGTCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056747742_1056747749 -10 Left 1056747742 9:89318769-89318791 CCCGCCTCGGGTCCGCCTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 142
Right 1056747749 9:89318782-89318804 CGCCTTGGGGTGGCGGTCAGCGG 0: 1
1: 0
2: 0
3: 11
4: 136
1056747734_1056747749 17 Left 1056747734 9:89318742-89318764 CCTACCGGGTGGCCGCGATCTTC 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1056747749 9:89318782-89318804 CGCCTTGGGGTGGCGGTCAGCGG 0: 1
1: 0
2: 0
3: 11
4: 136
1056747736_1056747749 5 Left 1056747736 9:89318754-89318776 CCGCGATCTTCGCGCCCCGCCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1056747749 9:89318782-89318804 CGCCTTGGGGTGGCGGTCAGCGG 0: 1
1: 0
2: 0
3: 11
4: 136
1056747733_1056747749 18 Left 1056747733 9:89318741-89318763 CCCTACCGGGTGGCCGCGATCTT 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1056747749 9:89318782-89318804 CGCCTTGGGGTGGCGGTCAGCGG 0: 1
1: 0
2: 0
3: 11
4: 136
1056747735_1056747749 13 Left 1056747735 9:89318746-89318768 CCGGGTGGCCGCGATCTTCGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1056747749 9:89318782-89318804 CGCCTTGGGGTGGCGGTCAGCGG 0: 1
1: 0
2: 0
3: 11
4: 136
1056747740_1056747749 -9 Left 1056747740 9:89318768-89318790 CCCCGCCTCGGGTCCGCCTTGGG 0: 1
1: 0
2: 1
3: 4
4: 86
Right 1056747749 9:89318782-89318804 CGCCTTGGGGTGGCGGTCAGCGG 0: 1
1: 0
2: 0
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056747749 Original CRISPR CGCCTTGGGGTGGCGGTCAG CGG Intronic