ID: 1056748190

View in Genome Browser
Species Human (GRCh38)
Location 9:89323430-89323452
Sequence GAGCCAGGCGAGCAAAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056748188_1056748190 -6 Left 1056748188 9:89323413-89323435 CCTTGGAGGGCAGGTGAGAGCCA 0: 1
1: 0
2: 3
3: 34
4: 388
Right 1056748190 9:89323430-89323452 GAGCCAGGCGAGCAAAGTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056748190 Original CRISPR GAGCCAGGCGAGCAAAGTCC AGG Intronic
900151421 1:1180822-1180844 GAGCAAGGCCAGCAAGGTGCCGG + Exonic
900359020 1:2279076-2279098 GAGACAGGAGGGCAGAGTCCAGG - Intronic
902736021 1:18401469-18401491 GAACCAGGCTAGGGAAGTCCTGG + Intergenic
903197962 1:21707565-21707587 GAGCCAGAGGAGAAAGGTCCTGG - Intronic
903463386 1:23534858-23534880 GAGCCAGGTAAGCAAAGCCTGGG - Intergenic
904155967 1:28483352-28483374 GACCCAGGCGATCAAGGCCCAGG + Intronic
906047512 1:42843277-42843299 GGGCCAGGCGACTGAAGTCCAGG - Exonic
911083636 1:93957935-93957957 GAGATAGGAGAGCAAAGTCATGG - Intergenic
919360247 1:196583829-196583851 GAGCCAGGAAAGAAAAGTTCAGG + Intronic
919774479 1:201185209-201185231 GAGCCAGGAGACCCGAGTCCTGG - Intergenic
920434663 1:205940105-205940127 GAGCCAGGAGAGCAGAGGGCAGG + Intronic
920825466 1:209420930-209420952 GAGCCATGTGAGCAGAGACCAGG + Intergenic
922174141 1:223181995-223182017 GATCCATGCTAGCAAAGACCTGG + Intergenic
923914944 1:238491671-238491693 GAGGCTGGAGAGCAAAATCCCGG + Intergenic
1065123951 10:22554922-22554944 GAGCCAGGCTAGCACAGGCAGGG + Intronic
1068134669 10:52940099-52940121 CCGCCAGGCGACCCAAGTCCAGG + Intergenic
1069920869 10:71814976-71814998 GAGCCAGGAGACCACAGCCCAGG + Exonic
1070961264 10:80501817-80501839 GACCCAGGCAAGCACTGTCCTGG + Intronic
1072970785 10:100015621-100015643 TAGCCAGGGGACCAAATTCCAGG + Intergenic
1073328929 10:102658402-102658424 GACCCAGGGGAGCAAAATCAAGG - Exonic
1075513784 10:123093571-123093593 GATCAAGGCCAGCAAAGACCAGG - Intergenic
1076693766 10:132237200-132237222 GAGCCCAGGGAGCACAGTCCAGG - Intronic
1082028353 11:47588317-47588339 GTGCCAGGAGAGCGAAGACCTGG - Exonic
1083425302 11:62581330-62581352 GACACAGGAGAGCAAAGGCCAGG + Intronic
1083726772 11:64632603-64632625 GAGCCAGGCTGGCAGAGTGCCGG + Intronic
1084037995 11:66524833-66524855 GAGGCAGGCGATCACAGTTCTGG + Intronic
1084527235 11:69704784-69704806 GGGCCAGGAGCGCAAAGCCCAGG - Intergenic
1084751058 11:71204778-71204800 GAGCCACGCCAGACAAGTCCTGG + Intronic
1087951691 11:104228535-104228557 GAGACTGGCCAGCAAAGCCCTGG - Intergenic
1090028259 11:123185680-123185702 GGGCCAGGCAGGCAGAGTCCGGG - Intronic
1091560645 12:1610330-1610352 CAGCCAGGCCAGAAAAGGCCAGG - Intronic
1091768073 12:3134812-3134834 TAGTCAGGCGATCACAGTCCAGG + Intronic
1092229400 12:6768275-6768297 GGGCCAGGAGAGCAAAGAGCTGG - Intronic
1096634454 12:52949491-52949513 GAGGCTGGAGAGCAAAATCCGGG + Exonic
1096818836 12:54218196-54218218 GAGCCAGGGGAGCCGGGTCCGGG - Intergenic
1101630085 12:106484771-106484793 GAGCCAGCCGAGCAAAAGTCTGG + Intronic
1101965010 12:109276582-109276604 GAGTCAGGTGTGCAGAGTCCAGG - Intergenic
1102389270 12:112536479-112536501 GAACCAGGCCGGCAAAGACCTGG + Intergenic
1102571137 12:113827663-113827685 GAGGCAGGCGTGAACAGTCCGGG + Intronic
1102738053 12:115180723-115180745 GAGGAAGGTGAGCTAAGTCCTGG - Intergenic
1103218993 12:119227415-119227437 GAGCCAGCTGTGCAAAGTGCTGG - Intergenic
1106756061 13:32824169-32824191 GAGACAGGGGAGCAGAGCCCTGG + Intergenic
1114035910 14:18626970-18626992 GGGCGAGGCGAGCACAGGCCTGG + Intergenic
1115478351 14:33837501-33837523 GAGCCAGGAGGGCAAAGTTGGGG - Intergenic
1117231715 14:53725622-53725644 GAGACAGAAAAGCAAAGTCCTGG - Intergenic
1119319074 14:73718814-73718836 GAGCCAGGCTGGCCCAGTCCTGG - Exonic
1119672477 14:76530093-76530115 GAGCCAGGCCAGCAAAGGAGGGG - Intergenic
1125518253 15:40334790-40334812 GAGCCAGGAGAGCCAGGTGCTGG + Exonic
1126780160 15:52132861-52132883 GAGCCAGGCAAGCAAAGAGCTGG - Intronic
1127342979 15:58066135-58066157 GAGAAAGGCCAGGAAAGTCCAGG + Exonic
1127733426 15:61820473-61820495 GAGTCCGGGGATCAAAGTCCTGG + Intergenic
1130967276 15:88706534-88706556 GAGCCAGCTGTGCAAAGTCTAGG - Intergenic
1132289239 15:100687938-100687960 GAACCAGAAGAGCAAATTCCAGG + Intergenic
1132495765 16:262596-262618 GAGGCAGGCGAGCAGAGCCATGG - Intronic
1133233154 16:4375870-4375892 CAGCCCGGCGGGCAAAGCCCTGG + Intronic
1135173098 16:20203879-20203901 GACCCAGGAGTGCAAAGGCCTGG - Intergenic
1138349624 16:56339591-56339613 GAGCCAGGCCAGGAGAGCCCTGG + Intronic
1141168729 16:81677795-81677817 GGGGCAGGAGAGCAGAGTCCTGG + Intronic
1146908364 17:36632309-36632331 GAGCCAGGAGAGCCAGCTCCCGG + Intergenic
1148766942 17:50045089-50045111 GGGCCCGCCAAGCAAAGTCCTGG + Intergenic
1150410078 17:64935232-64935254 GTGCCAGGAGAGCACAGCCCTGG + Intergenic
1154070160 18:11146633-11146655 GAGGCAGGTGAGCTGAGTCCAGG + Intronic
1158358652 18:56648123-56648145 GAGCAGGGTGAGGAAAGTCCAGG - Intronic
1160370505 18:78368886-78368908 GAGCCAGGAGAGGACAGCCCCGG + Intergenic
1160775401 19:853041-853063 GAGCCGGGCGCGCACACTCCCGG - Intronic
1162337548 19:10071140-10071162 GTGCCAGGCGAGGAGAGACCGGG + Intergenic
1162893254 19:13748930-13748952 GAGGCAGTGGTGCAAAGTCCCGG - Intronic
1164478701 19:28594833-28594855 CCCCCAGGAGAGCAAAGTCCTGG - Intergenic
1164679729 19:30125872-30125894 CAACCAGGCGAGGAAAGTCAGGG + Intergenic
1164944423 19:32281399-32281421 CAGCCAGGCCAGGAAAGTCAGGG - Intergenic
1166944347 19:46387933-46387955 GAGCCTGGCGAGCATATTCCAGG + Intronic
1168109409 19:54183653-54183675 GAGCCTGGCCAGTGAAGTCCAGG - Exonic
926445040 2:12931268-12931290 GAGAGAGGTGAGCAAAGTCCTGG + Intergenic
926724622 2:15987604-15987626 GAGGCAGGCAAGCAGAGGCCTGG - Intergenic
927603703 2:24466962-24466984 GAGCCAGGTGAGCTAAGAACTGG - Intergenic
928361197 2:30663586-30663608 GTGCCAGGCAAGCCATGTCCTGG + Intergenic
932073570 2:68643813-68643835 GAGCCCGGCAGGCAAGGTCCGGG - Exonic
936243210 2:110805903-110805925 GAGCCTGGAGAGCAAAGCTCTGG + Intronic
937014803 2:118595719-118595741 GAGCCAGGTGAGTCAAGTCTAGG - Intergenic
944662673 2:201934274-201934296 GCGGCAGGCAATCAAAGTCCTGG - Intergenic
946183909 2:217965995-217966017 GAGAGAGGAGAGGAAAGTCCTGG - Intronic
946688044 2:222291218-222291240 CAGCCGGGGGAGCCAAGTCCTGG - Intronic
947663949 2:231891264-231891286 GAGCAAGCCGAGCTATGTCCTGG - Intergenic
1170573623 20:17646935-17646957 GAGCCAGGTGTGCACAGTGCAGG - Intronic
1172963588 20:38816847-38816869 GGGCCAGGCGAGGTATGTCCTGG + Intronic
1174396713 20:50251177-50251199 CAGCCTGGGGAGCAGAGTCCGGG - Intergenic
1175673636 20:60928609-60928631 GAGCCAGAAGAGAAGAGTCCGGG - Intergenic
1178881773 21:36455599-36455621 GAGCCAGGTGAGAAATGCCCAGG - Intergenic
1179279918 21:39925473-39925495 GAACAAGGCGGACAAAGTCCCGG + Intronic
1180460033 22:15554024-15554046 GGGCGAGGCGAGCACAGGCCTGG + Intergenic
1183687207 22:39368010-39368032 GAGCCAGGCCTGCAAAGATCTGG - Intronic
1184226966 22:43134655-43134677 CAGCCTGGCGAGCACAGACCAGG + Intronic
950429124 3:12940890-12940912 GAGCCAGGAGAGGAGAATCCTGG - Intronic
951744406 3:25961305-25961327 GAGCCAGGGAAACAAAGCCCTGG + Intergenic
953925225 3:46979414-46979436 CAGTCAGGCGAGCAGCGTCCTGG + Intronic
954575697 3:51674848-51674870 GAGGCAGGGGACCAAAGTCCTGG - Intronic
955272660 3:57517074-57517096 GAGCCAGCCGTGGAAAGACCTGG - Intronic
961437367 3:126928628-126928650 GATCCAGGAGAGTGAAGTCCAGG + Intronic
966508244 3:180731250-180731272 CAGCCTGGGGAGGAAAGTCCAGG - Intronic
968262972 3:197339959-197339981 ATCCCAGGCGAGCAGAGTCCAGG - Intergenic
968735847 4:2296202-2296224 CACGCAGGCCAGCAAAGTCCTGG - Intronic
969089958 4:4686219-4686241 GAGCCTCGAGAGGAAAGTCCAGG + Intergenic
969290106 4:6233403-6233425 GAGACAGGTGAGCAAAGACCTGG - Intergenic
976948384 4:90798809-90798831 GAGCCAAGAGAACAAAGTCAGGG - Intronic
983554778 4:169050344-169050366 GAGCCAGGCGAGAAAAGATGAGG + Intergenic
984887688 4:184465235-184465257 GAGCCTGGCCAGGAAAGCCCTGG + Intronic
985092433 4:186378010-186378032 GAGCCAGGCCAGCAAGGACCAGG - Intergenic
988615902 5:32774538-32774560 GAGCCATGCCAGGAAAGTCATGG + Intronic
988617905 5:32793256-32793278 GAGCCAGGCTATGAAACTCCGGG - Intergenic
988775886 5:34477819-34477841 GGGCCAGGCAACCAAAGCCCAGG + Intergenic
989590412 5:43107701-43107723 GGGCCAAGCGAACAGAGTCCTGG - Intronic
992800183 5:80288741-80288763 GAGGCTGGAGAGCAAAGTCTGGG + Intergenic
998129729 5:139645623-139645645 GATCCAGGAGAGCACACTCCAGG + Intergenic
1001786631 5:174419224-174419246 GCGCCAGGAGATCAAAGTGCAGG + Intergenic
1003151995 6:3560420-3560442 GAGACATTCTAGCAAAGTCCAGG - Intergenic
1006465265 6:34190115-34190137 GAGGCTGGAGAGCAAAATCCAGG + Intergenic
1007494807 6:42252441-42252463 GAGCCTGGAGAGCAAATTCGGGG + Intronic
1016932812 6:149426775-149426797 GTGGCAGGTGAGCAAAGCCCAGG - Intergenic
1023885098 7:44348734-44348756 GGGCCAAGGGAGCAAAGTGCAGG + Intergenic
1025723488 7:64037218-64037240 CAGCCAGGCGACCAAAGAGCCGG + Intronic
1026428288 7:70318344-70318366 GAGCATGGGGAGGAAAGTCCAGG + Intronic
1026541029 7:71280173-71280195 GAGACAGGGGACCAGAGTCCAGG + Intronic
1026950198 7:74341757-74341779 GAACCAGGCTAGCAAAGGCGTGG - Intronic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1028480887 7:91303412-91303434 TAGCCAGGGGAGCAGAGTGCTGG + Intergenic
1028743284 7:94300626-94300648 CAGCCAGGCAAGCAGAGTCTTGG + Intergenic
1031927383 7:127651726-127651748 GAGCCACGCAGGCAGAGTCCTGG - Intergenic
1031935015 7:127727221-127727243 GAGCCAGGCGGGCCAGGTCTGGG - Intronic
1032804261 7:135339587-135339609 GTTCAAGGCAAGCAAAGTCCAGG - Intergenic
1032923832 7:136579177-136579199 GAGCAAGGAGAGCAAATTCAAGG + Intergenic
1034969402 7:155409627-155409649 GAGCCAGGTGAGCACAGCCTCGG - Intergenic
1035051253 7:156000194-156000216 AGGCCAGGCCAGCAAACTCCAGG - Intergenic
1036613487 8:10370578-10370600 GAGTACGGGGAGCAAAGTCCTGG + Intronic
1037561073 8:20074819-20074841 GAGCCACAGGAGCAGAGTCCTGG + Intergenic
1039517549 8:38146273-38146295 GATCAAGGTGAGCAAAGTCCAGG - Exonic
1039866744 8:41511556-41511578 GAGGCTGGAGAGCAAAATCCAGG + Intergenic
1040452220 8:47559498-47559520 CAGACAGGCAAGCAAAGGCCTGG - Intronic
1042061865 8:64826974-64826996 GAGCCAGGCCAGAGAAGTCAGGG - Intergenic
1044617286 8:94155427-94155449 TATCCAGTCCAGCAAAGTCCGGG + Intronic
1047732440 8:127737971-127737993 GAGCCCGGAGCGCAAAGCCCGGG - Intronic
1049570556 8:143368509-143368531 GAGCTAGGCGCGCCGAGTCCAGG + Intergenic
1049624949 8:143615738-143615760 GAGCTGGGCCAGCACAGTCCTGG + Intronic
1050008269 9:1157825-1157847 GAGGCAGGTTAGCATAGTCCAGG - Intergenic
1056748190 9:89323430-89323452 GAGCCAGGCGAGCAAAGTCCAGG + Intronic
1057214031 9:93218422-93218444 GAGCCCGGCGGGCACAGGCCAGG - Intronic
1058524006 9:105839167-105839189 TAGCCAGGCAGGCAAAGTCATGG + Intergenic
1058923715 9:109641337-109641359 GAGCCAGGGCTGCAATGTCCTGG + Intronic
1061014012 9:127971615-127971637 GAGCCAGGGGAGAAAAGCCCCGG + Intronic
1061817167 9:133204474-133204496 GAGCCAGGCCAGCAGGGCCCAGG - Intergenic
1062580491 9:137227283-137227305 GAGCCTGGCACGCTAAGTCCTGG - Exonic
1062605955 9:137348959-137348981 GCGAGAGGGGAGCAAAGTCCTGG - Intronic
1197115954 X:122834014-122834036 GAGCCATGTGAGCAAATTACAGG + Intergenic
1197617863 X:128714823-128714845 GAAGCAGGAGAGCAAAATCCGGG + Intergenic
1197922980 X:131615257-131615279 CACCCAGGAGAGCAAAGTCTGGG + Intergenic
1198442161 X:136673669-136673691 GAGCCAGGAGAGGAAAGTGAGGG - Intronic