ID: 1056751020

View in Genome Browser
Species Human (GRCh38)
Location 9:89351208-89351230
Sequence AGTAGATGAAAGCCCTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056751020_1056751022 2 Left 1056751020 9:89351208-89351230 CCTACCTAGGGCTTTCATCTACT 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1056751022 9:89351233-89351255 ACATTTTGTTGTTCAGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056751020 Original CRISPR AGTAGATGAAAGCCCTAGGT AGG (reversed) Intronic
900555347 1:3277502-3277524 AGTACAGGAAAGCCCCAGGCTGG + Intronic
902176861 1:14657005-14657027 TGAAGAAGACAGCCCTAGGTTGG - Intronic
903807459 1:26015783-26015805 AGAAAATGAAAGCCCAAGGCTGG + Intergenic
904303425 1:29571034-29571056 AGAACATGAAAGCTCTGGGTAGG - Intergenic
905345455 1:37308257-37308279 AGTGCATGAAAGGCCCAGGTGGG + Intergenic
914730383 1:150364610-150364632 AGTGCGTGAAAGCCGTAGGTGGG - Intronic
917294146 1:173501760-173501782 AGGAGAGGAAGGCCCTAGGAGGG + Intronic
918537806 1:185593826-185593848 ACTAGAAGAAAACCCTAGGTTGG + Intergenic
918703736 1:187636726-187636748 AGTAGTTAGAAGCACTAGGTAGG - Intergenic
920421556 1:205837790-205837812 GGGAGATGAAAGCCCCAGCTGGG + Intronic
1067027744 10:42858921-42858943 GGCAGATGACAGCCCCAGGTGGG - Intergenic
1068188373 10:53617481-53617503 TGTAGATGAAAGCCTAAGGGAGG + Intergenic
1068953069 10:62796706-62796728 AGTAAGTGAAAGCCCTTGCTGGG - Intergenic
1070328132 10:75401036-75401058 AGAAAAAGAAAGCCCTAGGGTGG + Intronic
1074693531 10:116028183-116028205 TGTAGATGCAAGCACCAGGTGGG + Intergenic
1085233731 11:74994807-74994829 AGTACAGGAAAGCCCTGTGTGGG + Intronic
1085719406 11:78899661-78899683 AGTAGATTAAAGCCCTCCTTGGG + Intronic
1086435924 11:86781298-86781320 AGTAGATGATCCTCCTAGGTAGG + Intergenic
1088628123 11:111747566-111747588 ATCAGATGAAAGGCCTGGGTGGG - Intronic
1090212324 11:124930102-124930124 AGTTGAAGAAAGCCCAAGGAAGG - Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1097659470 12:62413416-62413438 TGTAGATGAAAGTCTTATGTTGG - Intronic
1098143681 12:67476482-67476504 AGGAGATGCAATCCCTAAGTAGG + Intergenic
1101189397 12:102315747-102315769 AAAAGATGAAGGCCCAAGGTGGG + Intergenic
1102416325 12:112766124-112766146 AGAAGATGAGAGCCCAAAGTTGG + Intronic
1111788912 13:92827725-92827747 AGTAGCTGAAAGCCCTGATTGGG + Intronic
1113614984 13:111673911-111673933 AGTAGATGCCAGCTCTAAGTAGG - Intergenic
1113620454 13:111758825-111758847 AGTAGATGCCAGCTCTAAGTAGG - Intergenic
1115142676 14:30191375-30191397 AGGAGTTGAAAGCCATAGCTGGG - Intronic
1120271091 14:82313998-82314020 AGTAGATGAATGCTCTCTGTGGG + Intergenic
1120788864 14:88561377-88561399 ATTAAATGAAAGCCCTTGGCTGG + Intergenic
1121286080 14:92736996-92737018 AGTAGGTGAGAGCCGTTGGTTGG - Intronic
1122400779 14:101466106-101466128 AGTGGATGAATGCCCTATGGAGG + Intergenic
1123427393 15:20183750-20183772 GGCAGATGACAGCCCCAGGTGGG - Intergenic
1123536629 15:21190300-21190322 GGCAGATGACAGCCCCAGGTGGG - Intergenic
1126985826 15:54306751-54306773 AGGAGAGGAAAGCATTAGGTCGG + Intronic
1133587843 16:7213048-7213070 AGTAAATGAAAGCCAGAGATTGG + Intronic
1139138937 16:64237623-64237645 ATTAGATGAAAGCCCCAGGAGGG + Intergenic
1140285526 16:73599238-73599260 AGTAGAGGAGAGCCATAAGTTGG + Intergenic
1141307528 16:82880415-82880437 ATTAGATGAAGGCCCTCGGCAGG - Intronic
1142699721 17:1651533-1651555 AGGAGATGGAACCCTTAGGTTGG - Exonic
1144740237 17:17577715-17577737 AGCAGTTAAAAGCACTAGGTCGG + Intronic
1150117577 17:62567404-62567426 TGTAAATGAAATCCCTAAGTAGG + Intronic
1157574356 18:48733689-48733711 TGCAAATGAAAACCCTAGGTGGG - Intronic
1159090112 18:63838599-63838621 AGGAGGTGAAAGCACTTGGTTGG + Intergenic
1162495258 19:11019837-11019859 TGTAGGGGAAAGGCCTAGGTGGG + Intronic
1163088474 19:15001045-15001067 AGCAGAAGAAAGTCCTTGGTTGG + Intronic
1163749104 19:19064730-19064752 CGTGGAAGAAAGCCCAAGGTGGG - Intronic
925287341 2:2724468-2724490 AGTAGATGGAAGACTTAGGGAGG - Intergenic
926145191 2:10392930-10392952 AGAAGATGAAAGCCCCAGAAGGG - Intronic
927220200 2:20700190-20700212 AGTAGCTGAAAGCCCTGGAGAGG + Intronic
932706396 2:74028612-74028634 AGTAGATGAGAGAGCTAGATTGG + Intronic
933781847 2:85807923-85807945 AGTAGATCCAGGCCCTGGGTGGG + Intergenic
935335116 2:102008773-102008795 AGTACTTGAGAGCCCTAGGCGGG + Intronic
935665681 2:105510068-105510090 ACTAGGTGAAAGACATAGGTTGG - Intergenic
936455541 2:112670793-112670815 ATTTGTTGAAAGCCCTAGCTTGG - Intergenic
939716501 2:145590641-145590663 AGTAGATGCATGCCCCAGCTTGG + Intergenic
940180012 2:150921624-150921646 AGGACATGAAAGGCCTGGGTGGG - Intergenic
941389687 2:164896334-164896356 AGTAGATGAAAGCTCCTGGTAGG - Intronic
942261376 2:174167872-174167894 TGAAAATGAAAGCCCTTGGTTGG - Intronic
1168936057 20:1665970-1665992 AGGAGATGACAGCTCTAGGCGGG + Intergenic
1169966700 20:11225621-11225643 AGTAGATGAAATCCCTCTGGTGG - Intergenic
1172061790 20:32191392-32191414 AGTAGGTTAAAACCCTAGCTAGG - Intergenic
1175859261 20:62141503-62141525 AGTATTTGAAAGGCCCAGGTTGG - Intronic
1179070444 21:38066037-38066059 AGTAGATCCAAGCCATAGATGGG - Intronic
951206968 3:19935391-19935413 AGGATATGAAACCCCTAGCTTGG + Intronic
952892158 3:38050602-38050624 TGTAGATGAATGCCCTAGGTGGG - Intronic
954202294 3:49030897-49030919 AGTCCATGAGAGCCCTAGGCTGG - Intronic
954641922 3:52105806-52105828 CCTAGATGAAAGCCAGAGGTGGG - Intronic
955171176 3:56567036-56567058 AGTGGAGGAAAGAGCTAGGTAGG + Exonic
955540680 3:59972860-59972882 ATTTGATGAAAGCACTAGGTAGG - Intronic
959549804 3:107641514-107641536 AGTATAAGAAAACACTAGGTAGG - Intronic
960598561 3:119431494-119431516 AGTGGGTTAAAGTCCTAGGTGGG - Exonic
962655032 3:137534798-137534820 AGTAGATGTAAGCCATTGCTTGG - Intergenic
963442403 3:145356514-145356536 AGTAGTTAGAAGCACTAGGTAGG + Intergenic
964252509 3:154734982-154735004 AGAAGAAGAAACACCTAGGTGGG + Intergenic
965020139 3:163218366-163218388 AGTAGAATAAGGCACTAGGTAGG - Intergenic
968340727 3:197953262-197953284 AGCATTTGAGAGCCCTAGGTGGG + Intronic
968404401 4:327360-327382 AGTAGATGGAGGCCCTGGCTGGG - Intergenic
969986102 4:11212571-11212593 GGTAGATGCATGTCCTAGGTGGG - Intergenic
978281623 4:107023020-107023042 AGTAGATGTAACCCCTGGGAAGG + Intronic
978305418 4:107323119-107323141 AGTAGCTGGAGGCCCTAGTTGGG + Intergenic
979144111 4:117218991-117219013 AGTAGAATAAAGCCCTTGCTGGG - Intergenic
980100860 4:128539993-128540015 AGTAGCTGGAAGCTGTAGGTTGG + Intergenic
982863828 4:160486494-160486516 GGTAGATGAAGCCACTAGGTAGG + Intergenic
989336805 5:40327187-40327209 AAAAGATGAAAGCCCAATGTAGG - Intergenic
991238989 5:64434605-64434627 AATAAAGGAAAGTCCTAGGTAGG + Intergenic
992475168 5:77094869-77094891 AATAGATTAAAGCCCTACCTGGG - Intergenic
994190090 5:96859600-96859622 ACTAGATGAAAGGCCAAGGCAGG - Intronic
995886229 5:116897265-116897287 AGTAAATGGAAGGCCAAGGTGGG - Intergenic
997226265 5:132211589-132211611 ACAAGATGAAGTCCCTAGGTAGG + Intronic
998986708 5:147766080-147766102 AGTAGATCATAACCCAAGGTTGG - Intronic
1003808616 6:9754704-9754726 AGTAGATGAATGCTGTGGGTCGG - Intronic
1007150649 6:39687561-39687583 TGCAGATGAAAGGGCTAGGTGGG + Intronic
1008880142 6:56373246-56373268 AGCAGATGGAATCCCTAGGGTGG - Intronic
1014550081 6:122779850-122779872 AGTACATGAAGGCTCTAGGTAGG + Exonic
1017378506 6:153798953-153798975 AAAAGATGAAAGCCCGATGTAGG - Intergenic
1023674190 7:42613419-42613441 AATAGAAGAAAGCACAAGGTAGG - Intergenic
1023710720 7:42989618-42989640 AGTAGACTAGAACCCTAGGTGGG - Intergenic
1026420896 7:70235902-70235924 AGTAGATGGGAGCCCAAGGTGGG - Intronic
1026489144 7:70847813-70847835 AGTAGTTGGAAGCACTAGGTAGG - Intergenic
1032520627 7:132541239-132541261 AGCTGGTGAAAGCACTAGGTAGG - Intronic
1033072435 7:138216292-138216314 AAAAGATGAAAGCCCGATGTAGG - Intergenic
1038749733 8:30284340-30284362 AGTTGATGAAAGAACTAGTTGGG - Intergenic
1039387923 8:37152857-37152879 AGTAGCTAAAAGTCTTAGGTAGG + Intergenic
1041988675 8:63957750-63957772 AGTAGATGAAAGACTTTGGATGG - Intergenic
1045475628 8:102550027-102550049 AATGGATGAAAGTCATAGGTGGG + Intergenic
1053014004 9:34651625-34651647 AGTAGATGAGAACCCTGAGTGGG + Exonic
1055970605 9:81908307-81908329 AGAAGATGAAGGCCCAATGTAGG - Intergenic
1056751020 9:89351208-89351230 AGTAGATGAAAGCCCTAGGTAGG - Intronic
1061234329 9:129333840-129333862 AGGGGAGGAAAGCCCCAGGTGGG - Intergenic
1061594569 9:131620628-131620650 AGTAGAGGAAAGGCCAAGCTTGG - Intronic
1187533618 X:20117718-20117740 TGTCGTTGAAAGGCCTAGGTCGG - Intergenic
1188780389 X:34276928-34276950 AGGAGATGAAAGCCTTAATTAGG - Intergenic
1189691254 X:43618664-43618686 AGTAGATGAAAACTCTATCTGGG + Intergenic
1196780841 X:119382825-119382847 AATAGATTAATGCCCTAGGGAGG + Intergenic