ID: 1056751894

View in Genome Browser
Species Human (GRCh38)
Location 9:89357903-89357925
Sequence CCCCTGCTTCTCTGTGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 332}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056751881_1056751894 22 Left 1056751881 9:89357858-89357880 CCTGGTACCCACCCATAAGCATG 0: 1
1: 0
2: 2
3: 13
4: 85
Right 1056751894 9:89357903-89357925 CCCCTGCTTCTCTGTGGAGGTGG 0: 1
1: 0
2: 4
3: 33
4: 332
1056751880_1056751894 23 Left 1056751880 9:89357857-89357879 CCCTGGTACCCACCCATAAGCAT 0: 1
1: 0
2: 1
3: 3
4: 115
Right 1056751894 9:89357903-89357925 CCCCTGCTTCTCTGTGGAGGTGG 0: 1
1: 0
2: 4
3: 33
4: 332
1056751885_1056751894 11 Left 1056751885 9:89357869-89357891 CCCATAAGCATGAGGTCCACATT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1056751894 9:89357903-89357925 CCCCTGCTTCTCTGTGGAGGTGG 0: 1
1: 0
2: 4
3: 33
4: 332
1056751887_1056751894 -5 Left 1056751887 9:89357885-89357907 CCACATTACCCCATGTCACCCCT 0: 1
1: 0
2: 1
3: 11
4: 209
Right 1056751894 9:89357903-89357925 CCCCTGCTTCTCTGTGGAGGTGG 0: 1
1: 0
2: 4
3: 33
4: 332
1056751886_1056751894 10 Left 1056751886 9:89357870-89357892 CCATAAGCATGAGGTCCACATTA 0: 1
1: 0
2: 1
3: 9
4: 103
Right 1056751894 9:89357903-89357925 CCCCTGCTTCTCTGTGGAGGTGG 0: 1
1: 0
2: 4
3: 33
4: 332
1056751883_1056751894 15 Left 1056751883 9:89357865-89357887 CCCACCCATAAGCATGAGGTCCA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1056751894 9:89357903-89357925 CCCCTGCTTCTCTGTGGAGGTGG 0: 1
1: 0
2: 4
3: 33
4: 332
1056751884_1056751894 14 Left 1056751884 9:89357866-89357888 CCACCCATAAGCATGAGGTCCAC 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1056751894 9:89357903-89357925 CCCCTGCTTCTCTGTGGAGGTGG 0: 1
1: 0
2: 4
3: 33
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056751894 Original CRISPR CCCCTGCTTCTCTGTGGAGG TGG Intronic