ID: 1056752559

View in Genome Browser
Species Human (GRCh38)
Location 9:89363012-89363034
Sequence GCCTCACCTGAGGCACCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056752559_1056752565 2 Left 1056752559 9:89363012-89363034 CCAACAGGTGCCTCAGGTGAGGC 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG No data
1056752559_1056752568 19 Left 1056752559 9:89363012-89363034 CCAACAGGTGCCTCAGGTGAGGC 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1056752568 9:89363054-89363076 GGAGGGTTCCCCATCTGTCCAGG No data
1056752559_1056752563 1 Left 1056752559 9:89363012-89363034 CCAACAGGTGCCTCAGGTGAGGC 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1056752563 9:89363036-89363058 TCCAGCCAGGAGCTACCTGGAGG No data
1056752559_1056752562 -2 Left 1056752559 9:89363012-89363034 CCAACAGGTGCCTCAGGTGAGGC 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1056752562 9:89363033-89363055 GCATCCAGCCAGGAGCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056752559 Original CRISPR GCCTCACCTGAGGCACCTGT TGG (reversed) Intronic
900710227 1:4108839-4108861 GCCTCACCTCAGGGGCCTGCTGG + Intergenic
900794595 1:4700435-4700457 GCCTCACATGAGGATCCTCTGGG - Intronic
901561204 1:10072199-10072221 GGCTTACCTGATGCACCTATTGG - Exonic
903715054 1:25359183-25359205 GGCTCATCTAAGGCACCTGTGGG + Intronic
905183399 1:36179736-36179758 ACCTCCACTGAGGCTCCTGTGGG - Exonic
912750297 1:112282094-112282116 CTCTCATCTGAAGCACCTGTTGG + Intergenic
913480786 1:119287170-119287192 ACCTCAGCTGAAGCACCTCTAGG + Intergenic
914394012 1:147247536-147247558 CCCTCACCTGAAGCAGATGTTGG + Intronic
917072320 1:171165632-171165654 GCCTCACCAGAAGCAGATGTCGG + Intergenic
917080333 1:171251587-171251609 GCCTCACATGGGGCACCAGCTGG + Intronic
919903177 1:202058795-202058817 GCCTCACCTCTGGCCCCTGAGGG - Intergenic
921152684 1:212414581-212414603 CCCTCCCCTGACGCACCCGTCGG + Intronic
921734035 1:218606477-218606499 GCCTCACCAGAAGCAGATGTTGG + Intergenic
922222844 1:223621607-223621629 GCCACACATGAGCCTCCTGTAGG - Intronic
924193284 1:241578499-241578521 GCCACACTTGAGGCCACTGTGGG + Intronic
1062833542 10:622132-622154 GGCTGCCCTGAGGCACCTGCTGG + Intronic
1070824277 10:79381730-79381752 TGCTCACCTGAGTCACCTGCGGG - Intergenic
1073511167 10:104043494-104043516 GACTGACCTGGGGCACCTGGAGG + Exonic
1074528563 10:114281222-114281244 GCCTCACCTGAGGAGACTCTTGG - Intronic
1075808245 10:125205540-125205562 GTCTCACCAGAGTCACCTGCAGG - Intergenic
1076346553 10:129782745-129782767 GCCTGACCTCATGAACCTGTTGG + Intergenic
1076838515 10:133033148-133033170 GCCTCACCAGAGGCAGATGCCGG + Intergenic
1077231893 11:1461423-1461445 GCCTCATCTGGGGCGGCTGTGGG + Exonic
1077888630 11:6403640-6403662 GCCTCACCTGGGACTCCTCTTGG + Exonic
1079802659 11:24889661-24889683 GCCTCAGCTGAGCCAACTGTGGG - Intronic
1080495255 11:32811594-32811616 GCCTCACCTGAAGCAGATGCTGG - Intergenic
1080894867 11:36440762-36440784 GCCTCACCTGGGGCAGATGCTGG - Intronic
1081552282 11:44124969-44124991 CACTCACCTGTAGCACCTGTGGG - Exonic
1081611202 11:44564698-44564720 CCCTCACCTCAGGCAGCTGCTGG + Intronic
1083189201 11:61037084-61037106 GCCTTCCCTGAGGCTTCTGTGGG + Intergenic
1084455380 11:69265192-69265214 TCCTCAGCTGAGGCTCCTGCAGG - Intergenic
1087300975 11:96435064-96435086 ACCTCACCAGAGGCACATGCTGG - Intronic
1089606236 11:119643177-119643199 GCCTTGCCTGATGCACCTGGAGG + Intronic
1090188230 11:124751935-124751957 GCCTCACCTCAGGCGCCTTAGGG + Intronic
1094441204 12:30478852-30478874 ACCTCACCTGAGGCATCTTCTGG - Intergenic
1096194747 12:49642660-49642682 GCCTCACCTCCAGCACCTGTAGG - Exonic
1098158928 12:67629220-67629242 GCCTTACCTGTTGCTCCTGTTGG - Intergenic
1098303418 12:69077885-69077907 GCCTCACCAGAGGCAGATGCTGG - Intergenic
1101705212 12:107214999-107215021 GCACCCCCTGAGGAACCTGTGGG + Intergenic
1104706260 12:130949730-130949752 GCCTCCCCTCCGGCTCCTGTCGG - Intergenic
1106545005 13:30722930-30722952 GCCTCACCAGAAGCAGATGTTGG + Intronic
1106754743 13:32811262-32811284 GCCTGACCTGGGGGACCTGCAGG - Intergenic
1111618581 13:90694289-90694311 GCCTCACCAGAAGCAGCTGCTGG - Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1114399610 14:22397318-22397340 GCCTCCTCTGAGGAGCCTGTTGG + Intergenic
1122207212 14:100153786-100153808 GCCTCACCTGGGGCCGCTGCTGG - Intronic
1122744782 14:103891244-103891266 GCTCCCCCTGATGCACCTGTGGG - Intergenic
1123625632 15:22225147-22225169 GCCTGACCTCAGACACCTTTTGG + Intergenic
1129333733 15:74840441-74840463 GCCTTGCCTGAGGAAACTGTAGG + Intronic
1129961724 15:79692550-79692572 GCCTCCCCTGAGGCAGTTGCCGG - Intergenic
1130515311 15:84621781-84621803 GCCGCACATGAGGCATTTGTAGG - Exonic
1131106163 15:89736347-89736369 GCCTCCCCTGGGGGTCCTGTAGG - Intronic
1132383874 15:101386285-101386307 GCCTCCCCAGTGGCACCTGCTGG + Intronic
1132745240 16:1433675-1433697 GCCTCACCTGGGGGCCCTGGTGG - Intergenic
1135654537 16:24236121-24236143 TCCTTACCTGGGTCACCTGTGGG - Intergenic
1137626889 16:49914733-49914755 GCCTCACCCATGGCCCCTGTTGG - Intergenic
1137668569 16:50266199-50266221 GCCTGGCCTGAGCCTCCTGTGGG - Intronic
1138272709 16:55707435-55707457 GCCTCACCTTAGGCACTTAGTGG + Intergenic
1141531379 16:84648838-84648860 GCCGCACCTGTGTCACCTGCGGG - Intronic
1142668282 17:1474893-1474915 GCCTCCCCGCAGGCCCCTGTGGG + Intronic
1144336599 17:14276982-14277004 ATCTCACCCCAGGCACCTGTGGG + Intergenic
1144427124 17:15153706-15153728 GCCTCACCAGAAGCAGATGTTGG - Intergenic
1144958834 17:19033444-19033466 GCCTCACCAGAGGCACATGCCGG + Intronic
1144976325 17:19141080-19141102 GCCTCACCAGAGGCACATGCCGG - Intronic
1145276134 17:21431944-21431966 GCCTCACCAGAAGCAGATGTTGG + Intergenic
1145712423 17:26989835-26989857 GCCTCACCAGAAGCAAATGTTGG + Intergenic
1150477716 17:65487603-65487625 GCCTCACCAGAGGCAGATGCTGG - Intergenic
1151511162 17:74561038-74561060 CCCTCACCTCCGGCATCTGTTGG - Intergenic
1152121299 17:78420283-78420305 GCTTCACCAGAGGCACCAGTGGG + Intronic
1152636686 17:81433074-81433096 CCCGCCCCTGAGGCAGCTGTGGG + Intronic
1152683201 17:81680531-81680553 GCCCCACCTGGCACACCTGTGGG + Intergenic
1152782289 17:82231709-82231731 GCCCCACTTGGGGCACCAGTGGG + Intronic
1153107964 18:1550010-1550032 GCCTGACCTGTGGCTCCTTTTGG - Intergenic
1153485383 18:5592789-5592811 GCATCATCTTAGGGACCTGTGGG + Intronic
1158464177 18:57675087-57675109 GCCTCTGCTGAGGCTCCTGTGGG + Intronic
1160240462 18:77119094-77119116 GCTCCACCTCAGGGACCTGTGGG - Intronic
1160904243 19:1445104-1445126 GGTTCAGCTGAGGCACCTGCTGG + Intergenic
1161104585 19:2437029-2437051 GCCTCCCCTCTGGCTCCTGTGGG + Intronic
1161754957 19:6125892-6125914 GCCTCATCCAAGGCTCCTGTCGG - Intronic
1163485098 19:17580747-17580769 GCCTCGCGTGAGGAACCTGGTGG + Exonic
1163517247 19:17772477-17772499 GACACACCTGAGGCACATGAAGG + Exonic
1164435852 19:28228622-28228644 ACCTCATCTGGGGCACCTGGTGG - Intergenic
1164710009 19:30349294-30349316 GGCTGGCCTGGGGCACCTGTTGG + Intronic
1165334194 19:35157486-35157508 TCCTCACCTGGGGCTCGTGTCGG - Exonic
1165705328 19:37971978-37972000 GCATCACCTGATGGACCTTTGGG + Intronic
1167564128 19:50245742-50245764 GCATTACCTGAGGCACCTGGGGG + Intronic
1167645149 19:50701760-50701782 GCCACACCTGCGGCACGTGGTGG + Intronic
1167720285 19:51175025-51175047 GCATCATCTTTGGCACCTGTGGG - Intergenic
925329046 2:3044035-3044057 GCCTCACATGACCCACCTTTAGG - Intergenic
925333335 2:3075375-3075397 GGCTGACCTGAGTCACCTTTAGG - Intergenic
926121775 2:10245168-10245190 GGCAACCCTGAGGCACCTGTCGG + Intergenic
926166559 2:10524825-10524847 GCCTCACCAGAAGCAGATGTCGG - Intergenic
926188445 2:10709442-10709464 CCCTCACCTGAGGATGCTGTGGG - Intergenic
926385167 2:12328573-12328595 GCCTCACCAGAAGCAAGTGTGGG + Intergenic
933773745 2:85759398-85759420 GCCTTACCTGAGCCTGCTGTGGG + Intronic
935108947 2:100074126-100074148 GCCTTGCCTGAGACACCTGACGG - Intronic
937327764 2:121001948-121001970 GCCTCACCAGAAGCAAATGTTGG + Intergenic
937958733 2:127438545-127438567 AACCCACCTGAGGAACCTGTGGG - Intronic
938488760 2:131745321-131745343 TCTTCACCTGAGGCAGGTGTTGG + Intronic
942947686 2:181687398-181687420 GCCTCACATCACGCAACTGTAGG - Intergenic
946435414 2:219648756-219648778 GCCTCACCTCAGGCACTAGCTGG + Intergenic
946584705 2:221172054-221172076 GCCATACCTGAGGCAAGTGTGGG - Intergenic
948116278 2:235495767-235495789 GACTCACCTGGGGCACCAGGTGG + Intronic
948535014 2:238639182-238639204 TCCTCACCTGAGGCAACTCACGG + Intergenic
1170443306 20:16399914-16399936 GCCTGAACTGAGGCAGCAGTGGG - Intronic
1170574555 20:17652631-17652653 GCCCAACCTGAGGCAACTGTAGG - Intronic
1170628694 20:18049773-18049795 GCCTGTCCTGAGGGAACTGTAGG - Intronic
1170812835 20:19687943-19687965 GCCTCAGGTGAAGCATCTGTTGG - Intronic
1173657034 20:44706604-44706626 GGCTCGCCTGGGGCAGCTGTGGG - Intergenic
1173905634 20:46626590-46626612 GCCTCAGCTGAGCTTCCTGTGGG + Intronic
1175159250 20:56995761-56995783 ACCTCACCTGTGCCACCTGGTGG + Intergenic
1178293141 21:31386676-31386698 GCCATACCTGTGGCACATGTTGG - Intronic
1178671703 21:34596493-34596515 CCCTCAGCTGAGGCTCCAGTGGG - Intronic
1178724093 21:35035972-35035994 GCCTCCCCAGAGGCTGCTGTGGG + Intronic
1178918464 21:36722789-36722811 GCCACCCCTGAGGCCCCTGATGG - Intronic
1179891118 21:44335534-44335556 GCCTCACCTGGGCCTCCTGATGG - Intronic
1179910229 21:44443590-44443612 GCCTTCCCTGTGGCACCTGGAGG - Intergenic
1180078163 21:45473623-45473645 GGCTCATCTGAGGCAGCTGATGG - Intronic
1180976501 22:19851622-19851644 GCCTCACCACAGGCAGCTGAGGG + Exonic
1181463752 22:23099860-23099882 GCCCCACTGGAGGCACCTGAGGG + Intronic
1181491057 22:23261021-23261043 GACTTACCTGAGCCACCTGGAGG + Exonic
1182309332 22:29393571-29393593 GCCACACCTGGGGCACATGTGGG + Intronic
1184650771 22:45918622-45918644 GCCTCACCACCGGCAGCTGTGGG + Intergenic
1184727392 22:46354945-46354967 GCCAGTCCTGGGGCACCTGTGGG + Intronic
949813966 3:8038928-8038950 GCCTCACCAGAGGCAGGTGCTGG - Intergenic
950053958 3:10011016-10011038 CCCTCACCTGAGGCCTCTGGAGG + Intronic
950555026 3:13690143-13690165 GCATGAACTGAGGCCCCTGTGGG + Intergenic
953091143 3:39727099-39727121 GCCTCACCAGAAGCAGATGTTGG - Intergenic
953465511 3:43115932-43115954 GCCTCACCTTAGGTGCCTCTTGG - Intergenic
953679548 3:45029135-45029157 GCTCCACCTGAGGAAGCTGTGGG - Intronic
953710930 3:45270180-45270202 GACTCACCAGAGCCACATGTAGG + Intergenic
954067135 3:48115853-48115875 GCCTCAAGTGATCCACCTGTGGG + Intergenic
955417355 3:58704947-58704969 ACACCACCTGAGGAACCTGTTGG + Intergenic
958072405 3:88631260-88631282 GCCTCACGTGAAGGACTTGTAGG + Intergenic
958450161 3:94263040-94263062 CCCTCAGCAGAGGCACCTGCAGG - Intergenic
959204112 3:103283278-103283300 GCCTCCCCTGAGGCAGTTGCTGG - Intergenic
959781301 3:110237034-110237056 GCCACTACTGAGGCAGCTGTGGG - Intergenic
965865557 3:173200521-173200543 GCCTCACCAGAGGCAGGTGCTGG - Intergenic
966434641 3:179869638-179869660 GCCTCCCCTGAAGCACAGGTAGG + Intronic
966924610 3:184636122-184636144 CCCTCTCCTGGGGCTCCTGTTGG - Intronic
967237755 3:187403603-187403625 ACCTAACCTGAGGAACCTGGAGG + Intergenic
968832740 4:2941575-2941597 GCCTCACCTGGAGCTCCTGCGGG + Exonic
969315553 4:6379655-6379677 GCTTCACCAGATGCACCTGTGGG - Intronic
970378448 4:15481629-15481651 GCCTCACCAGAGGCAGATGCTGG + Intronic
970944512 4:21674827-21674849 GCCACACCTGAGTAACCTTTGGG + Intronic
971628137 4:28950766-28950788 GCCTCTCCTGAGGCACAGGAAGG - Intergenic
971681214 4:29703502-29703524 GCCTCACCGGAGGTAGCTGCTGG + Intergenic
973854797 4:55000518-55000540 ACCTAACCTGGGGCACCTTTTGG + Intergenic
976703906 4:88002079-88002101 GCCACACCTGAGACACATATAGG + Intergenic
976775720 4:88703886-88703908 GGATCACCTGAGGCACTTGGTGG + Intronic
980221268 4:129919228-129919250 GCCTCACCAGAAGCACATGCTGG - Intergenic
980367047 4:131818251-131818273 GCCTTGACTGAGGCATCTGTGGG + Intergenic
981415567 4:144488818-144488840 GTACCACCTGAGGCATCTGTGGG + Intergenic
984833690 4:183999648-183999670 GCTTCCTCCGAGGCACCTGTTGG + Intronic
985171002 4:187150233-187150255 GCCTCACCAGAGGCAGGTGCTGG - Intergenic
985362674 4:189192448-189192470 GCCTCACCTGAAGCACATGCTGG - Intergenic
988253176 5:28786935-28786957 ACCTCACCAGAAGCACCTTTAGG - Intergenic
988656320 5:33215826-33215848 GCCTCACCAGAGGCAGATGCCGG - Intergenic
989307989 5:39979778-39979800 GCCTCACCAGAAGCAGATGTTGG + Intergenic
990985127 5:61634416-61634438 GCCTCACCCGGGGCCACTGTTGG + Intergenic
992774888 5:80080447-80080469 CCCTCCCCTGTGGCACCTCTGGG + Intronic
994620423 5:102155352-102155374 GCTCCACCTAAGGCCCCTGTGGG + Intergenic
995252682 5:110012337-110012359 GCCTCTCATGGGGCACCTGATGG + Intergenic
998256752 5:140594238-140594260 GACTCACCTGAGGCACAAGTCGG + Intergenic
999720508 5:154395938-154395960 GCCTCATCGGAAGCACCTGCAGG - Intronic
1000120899 5:158196962-158196984 GCCTCACCAGAAGCAGATGTTGG + Intergenic
1001484665 5:172111059-172111081 ACCTCACTTGCAGCACCTGTTGG - Intronic
1003256397 6:4478963-4478985 GCCTCACCTTGGTCACCTGTGGG + Intergenic
1007343585 6:41209592-41209614 CACTCACCTGTGGCACCTGCAGG + Intergenic
1012118178 6:95331234-95331256 GCCTCAGCTGAGTCCCCAGTTGG - Intergenic
1012958739 6:105599472-105599494 GCGTTCCCTGAGGCAACTGTTGG + Intergenic
1013480549 6:110549422-110549444 GCCTCATCTGGGCCACCTGGTGG - Intergenic
1017766800 6:157613585-157613607 GCCACACGATAGGCACCTGTTGG + Intronic
1018899993 6:168046272-168046294 TCCTCACCTGAGCCGCATGTGGG - Intergenic
1019295545 7:272172-272194 GCGGCACCTGAGGCCCCTGCAGG + Intergenic
1019459943 7:1152460-1152482 GCCTCAACTGTTGCACCTGGTGG - Intronic
1019613402 7:1948115-1948137 GCCTCATCTGGGGCACCTGCAGG + Intronic
1019853205 7:3579872-3579894 GACTCACCCAAGGCACCTCTGGG - Intronic
1020751582 7:12147723-12147745 GCCTCCCCTGAGGCAGTTGTCGG - Intergenic
1021954472 7:25810444-25810466 GCCTCACCAAAAGCAGCTGTGGG + Intergenic
1022634501 7:32119332-32119354 GCCTCACTTCAGGCTCCTGTTGG + Intronic
1023515360 7:40996340-40996362 GCCTCAGCTTCTGCACCTGTGGG + Intergenic
1023859969 7:44212742-44212764 GCCTCTCCTGGGGCCACTGTTGG + Exonic
1024062772 7:45711039-45711061 ACCTCATCTGAGGAACTTGTGGG + Intronic
1024232906 7:47376332-47376354 GCCTCACCTGGCTCACCTGAGGG - Intronic
1024884681 7:54127149-54127171 GCCTCCCCTGAGGCAGTTGCTGG - Intergenic
1037731963 8:21533646-21533668 CCCTCACCAGAGGCACATGCTGG - Intergenic
1037977332 8:23222963-23222985 GCCTCACCAGAGGCAGATGCTGG + Intronic
1038022221 8:23560372-23560394 GCCTCTCCTGAGGCTGCTGCAGG + Intronic
1039796305 8:40918422-40918444 GCCCCGCCTTAGGGACCTGTGGG - Intergenic
1043470295 8:80555436-80555458 GCCTCAGCTGAGGCTGCTGCTGG - Intergenic
1043552121 8:81386438-81386460 GCCTGACCTGAGACTCCAGTAGG + Intergenic
1043946008 8:86253400-86253422 GCCACAGCTGAGGCAACTGAGGG + Intronic
1044529186 8:93289001-93289023 ACCTCACCTGCCCCACCTGTAGG + Intergenic
1045767399 8:105690609-105690631 GACTCACCTTGGACACCTGTGGG + Intronic
1056056855 9:82833664-82833686 GCCTCACCAGAAGCAGATGTTGG + Intergenic
1056752559 9:89363012-89363034 GCCTCACCTGAGGCACCTGTTGG - Intronic
1057723811 9:97554385-97554407 GTGGCACTTGAGGCACCTGTGGG + Intronic
1057884512 9:98819779-98819801 GGCCCACCTGAGCCTCCTGTTGG + Intronic
1058872177 9:109212085-109212107 GGCCTACCTGAGACACCTGTGGG - Intronic
1062381645 9:136289833-136289855 GCCCCACCTGAGGAGCCTCTCGG + Intronic
1062569154 9:137176684-137176706 ACCTCACTGGAAGCACCTGTTGG - Intronic
1188800491 X:34524167-34524189 GCCTCACCTTACTCACCTCTGGG + Intergenic
1193879839 X:86908470-86908492 CACAGACCTGAGGCACCTGTGGG + Intergenic
1197720882 X:129743839-129743861 GCCTCTCCTGAAGCAGCGGTTGG - Intronic
1197838364 X:130719269-130719291 TCAACACCTGAGGCAGCTGTGGG - Intronic
1197978820 X:132194496-132194518 GCTCCACCTGCGGCCCCTGTGGG + Intergenic
1198103920 X:133444950-133444972 GTCTCACCTGCTGCATCTGTTGG - Intergenic
1199867670 X:151868046-151868068 GCCTTACCAGAGGCACATGCTGG + Intergenic
1201430243 Y:13895515-13895537 ACATCCCCTGAGGAACCTGTGGG + Intergenic
1201743750 Y:17349455-17349477 ACATACCCTGAGGCACCTGTGGG - Intergenic