ID: 1056752565

View in Genome Browser
Species Human (GRCh38)
Location 9:89363037-89363059
Sequence CCAGCCAGGAGCTACCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056752550_1056752565 15 Left 1056752550 9:89362999-89363021 CCCCCTGACCCCTCCAACAGGTG 0: 1
1: 0
2: 2
3: 19
4: 280
Right 1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG No data
1056752555_1056752565 7 Left 1056752555 9:89363007-89363029 CCCCTCCAACAGGTGCCTCAGGT 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG No data
1056752548_1056752565 20 Left 1056752548 9:89362994-89363016 CCACTCCCCCTGACCCCTCCAAC 0: 1
1: 0
2: 9
3: 80
4: 987
Right 1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG No data
1056752556_1056752565 6 Left 1056752556 9:89363008-89363030 CCCTCCAACAGGTGCCTCAGGTG 0: 1
1: 0
2: 2
3: 42
4: 261
Right 1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG No data
1056752551_1056752565 14 Left 1056752551 9:89363000-89363022 CCCCTGACCCCTCCAACAGGTGC 0: 1
1: 0
2: 0
3: 31
4: 259
Right 1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG No data
1056752553_1056752565 12 Left 1056752553 9:89363002-89363024 CCTGACCCCTCCAACAGGTGCCT 0: 1
1: 0
2: 3
3: 23
4: 294
Right 1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG No data
1056752559_1056752565 2 Left 1056752559 9:89363012-89363034 CCAACAGGTGCCTCAGGTGAGGC 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG No data
1056752557_1056752565 5 Left 1056752557 9:89363009-89363031 CCTCCAACAGGTGCCTCAGGTGA 0: 1
1: 0
2: 1
3: 13
4: 161
Right 1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG No data
1056752552_1056752565 13 Left 1056752552 9:89363001-89363023 CCCTGACCCCTCCAACAGGTGCC 0: 1
1: 0
2: 0
3: 20
4: 213
Right 1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG No data
1056752560_1056752565 -8 Left 1056752560 9:89363022-89363044 CCTCAGGTGAGGCATCCAGCCAG 0: 1
1: 0
2: 1
3: 24
4: 318
Right 1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056752565 Original CRISPR CCAGCCAGGAGCTACCTGGA GGG Intronic
No off target data available for this crispr