ID: 1056753580

View in Genome Browser
Species Human (GRCh38)
Location 9:89368482-89368504
Sequence CCAGAAGGGTCCCCAGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 259}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056753580_1056753588 -1 Left 1056753580 9:89368482-89368504 CCAGACTCTGGGGACCCTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 259
Right 1056753588 9:89368504-89368526 GGGACAAGGACAGTGCAGCTGGG 0: 1
1: 0
2: 1
3: 25
4: 207
1056753580_1056753589 0 Left 1056753580 9:89368482-89368504 CCAGACTCTGGGGACCCTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 259
Right 1056753589 9:89368505-89368527 GGACAAGGACAGTGCAGCTGGGG 0: 1
1: 0
2: 2
3: 23
4: 331
1056753580_1056753587 -2 Left 1056753580 9:89368482-89368504 CCAGACTCTGGGGACCCTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 259
Right 1056753587 9:89368503-89368525 GGGGACAAGGACAGTGCAGCTGG 0: 1
1: 0
2: 2
3: 39
4: 274
1056753580_1056753592 22 Left 1056753580 9:89368482-89368504 CCAGACTCTGGGGACCCTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 259
Right 1056753592 9:89368527-89368549 GGTATGCCCTGAGGCCTTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 98
1056753580_1056753591 13 Left 1056753580 9:89368482-89368504 CCAGACTCTGGGGACCCTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 259
Right 1056753591 9:89368518-89368540 GCAGCTGGGGGTATGCCCTGAGG 0: 1
1: 0
2: 3
3: 23
4: 216
1056753580_1056753590 1 Left 1056753580 9:89368482-89368504 CCAGACTCTGGGGACCCTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 259
Right 1056753590 9:89368506-89368528 GACAAGGACAGTGCAGCTGGGGG 0: 1
1: 0
2: 2
3: 31
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056753580 Original CRISPR CCAGAAGGGTCCCCAGAGTC TGG (reversed) Intronic
900525789 1:3127942-3127964 CCAGAAGGCTGACCAGAGGCGGG - Intronic
901182344 1:7350274-7350296 CCAGGAGGGTCCCCAGGAGCAGG + Intronic
901490318 1:9593342-9593364 CCTGAAAGGTCCCAAGAGGCAGG - Intronic
901639787 1:10687415-10687437 CCAGAGGAGACCCCAGAGTCAGG + Intronic
902126339 1:14215303-14215325 TCAGGAGAGTCCCCAGAGTGTGG + Intergenic
902168276 1:14590263-14590285 CCAAATGGGTCCCCAGGGCCTGG + Intergenic
902923012 1:19678653-19678675 CCAGCAGGATGCCCAGCGTCAGG - Exonic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
904774919 1:32900867-32900889 CCAGAAGGGACCCCGGGGCCAGG - Intronic
904841364 1:33373816-33373838 CCAGAACGGGGCCCAGGGTCAGG + Intronic
906453471 1:45972744-45972766 CTGGAAGGGTTTCCAGAGTCAGG - Intronic
906717326 1:47979867-47979889 GCAGAAGGGTTCCCAGCTTCTGG - Intronic
906786578 1:48621180-48621202 CCAGAAGGCTCCCCATATTCAGG - Intronic
910450550 1:87339444-87339466 CCAAAGGGATGCCCAGAGTCTGG + Intronic
911569186 1:99502149-99502171 CCAGATTGATCCCCAGAGACTGG + Intergenic
913264087 1:117027455-117027477 TGGGAAGGTTCCCCAGAGTCTGG + Intronic
913302005 1:117381346-117381368 CCACAACAGTCCCCAGAGTGTGG + Intronic
913712062 1:121495086-121495108 ACAGAAGGGTCTATAGAGTCAGG - Intergenic
915622280 1:157092979-157093001 CAAGAAGGGCCCCGAGAGACAGG + Exonic
916984305 1:170174273-170174295 GCAGAAGGGTTCCCAGAATAGGG - Intergenic
922245070 1:223787973-223787995 GCAGAAGGGTCACCTGAGCCTGG + Intronic
922597438 1:226824732-226824754 CCAGCAAGGTCACCTGAGTCTGG + Intergenic
923193261 1:231641002-231641024 CCAGCAGGGTCTCCAGAGCATGG - Intronic
923208067 1:231777629-231777651 CCAGATGGGTGCCCGGAGTGAGG + Intronic
1064323440 10:14327567-14327589 ACAGAAGCGGCCACAGAGTCTGG - Intronic
1066634032 10:37483503-37483525 CAAGCAGGGTCCGCAGGGTCAGG - Intergenic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1067511102 10:46895715-46895737 CCAGAAGAGTCCCCAGAGAGTGG + Intergenic
1067651151 10:48156147-48156169 CCAGAAGAGTCCCCAGAGAGTGG - Intergenic
1069750023 10:70739232-70739254 GCAGAAGATTCCCCAGAGTCTGG + Intronic
1069887679 10:71634249-71634271 CCAGAAGGGGCCCCAGAAGGAGG + Intronic
1070690670 10:78522602-78522624 GCAGAAGGGGGTCCAGAGTCAGG - Intergenic
1072488793 10:95882670-95882692 CCACAACAGTCCCCAGAGTGTGG - Intronic
1073084896 10:100882039-100882061 CCAGAAGCCTCCCCAGAATGGGG - Intergenic
1074440368 10:113472383-113472405 CCAGCAGGGGCCACAGAGCCTGG - Intergenic
1076674217 10:132139977-132139999 CCTGGAGGGTCCCCAAAGGCAGG + Intronic
1076687423 10:132204389-132204411 CCAGAAGCGACGCCAGAGGCCGG - Intronic
1077240493 11:1508082-1508104 CCAAGAGGGTCCCCACAGCCAGG - Intergenic
1081675437 11:44965939-44965961 ACACAAGGGTCTCCAAAGTCGGG + Intergenic
1083572459 11:63768077-63768099 CCCGAAGGGGACCCAGGGTCTGG + Intronic
1088673262 11:112165127-112165149 ACAGAGGGGTTCCTAGAGTCAGG + Intronic
1089149484 11:116353873-116353895 CCAGAGGTGCCTCCAGAGTCAGG + Intergenic
1089214185 11:116825866-116825888 GCAGAAGGGGTGCCAGAGTCAGG - Intergenic
1090639391 11:128717438-128717460 CCAGAAGGACCTCCAGAATCTGG - Intronic
1091547306 12:1510003-1510025 TCAGGAGGGTCCCCAGAGCTCGG + Intergenic
1091715344 12:2772666-2772688 CCAGAAGGGTCACAGGAGGCTGG - Intergenic
1092158653 12:6302518-6302540 GCAGAAGGGTCACCTGAGCCTGG + Intergenic
1092210079 12:6640208-6640230 CAGGTAGGGTCCCCAGAATCAGG - Exonic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1094376679 12:29797719-29797741 ACAGAAGGGGCCCCAAATTCTGG - Intergenic
1094636521 12:32231750-32231772 CCACAACAGTCCCCAGAGTGGGG + Intronic
1094864116 12:34508715-34508737 CCACAACAGTCCCCAGAGTGTGG - Intergenic
1095401945 12:41824181-41824203 CCACAACAGTCCCCAGAGTGTGG - Intergenic
1095869008 12:47005095-47005117 CCATAAGAGTCTTCAGAGTCAGG + Intergenic
1096519335 12:52175426-52175448 TCAGGAGGGCGCCCAGAGTCAGG - Intronic
1096524601 12:52202922-52202944 CCAGAAAGGGCCACAGTGTCTGG - Intergenic
1096789451 12:54035799-54035821 CCAAATGGGTCCCTAGAGTGAGG - Intronic
1097065085 12:56315172-56315194 CCAGCAGGGCCCCCAGAAGCAGG + Exonic
1097614328 12:61865222-61865244 CCAAAGGGGTCTCCAAAGTCTGG + Intronic
1099842508 12:87983551-87983573 CCACAACAGTCCCCAGAGTGTGG + Intronic
1101430530 12:104623240-104623262 CAGGAAGGCTCCCCAGAGTCAGG + Intronic
1102513461 12:113431038-113431060 CAACAAGGGTCCCCAGGGTTGGG + Intronic
1103606332 12:122088433-122088455 CCAGAAGGGGCTCCAGCATCTGG + Intronic
1103842957 12:123880033-123880055 CATGGAGGGTCCCCAGATTCTGG + Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1107414551 13:40188598-40188620 CCAGAAGGGTCAGCACAGCCAGG + Intergenic
1107439535 13:40413005-40413027 CTATAAAGGTCCCCACAGTCTGG + Intergenic
1109757373 13:66778112-66778134 CCACAACAGTCCCCAGAGTGTGG - Intronic
1111872085 13:93845813-93845835 CCACAACAGTCCCCAGAGTGTGG - Intronic
1113450850 13:110408225-110408247 CCACAAGGGTCCCCAGGGCGGGG + Intronic
1115383557 14:32768917-32768939 CAACAAGGGTCCTCAGAGTACGG - Intronic
1117503944 14:56381994-56382016 CAATAATGGTCACCAGAGTCTGG - Intergenic
1117801695 14:59450127-59450149 TCAGAAGGGTTCCTACAGTCTGG + Intronic
1121186117 14:91971330-91971352 CCAGAAGCTTGCCCAGAGTTCGG - Intronic
1121308975 14:92924535-92924557 CCAGTAGGCTCCCCAGGGGCTGG + Intronic
1121430347 14:93881977-93881999 CCAGGATGGTCCAAAGAGTCTGG + Intergenic
1121432488 14:93897915-93897937 CCAGGAGGGTCCCTGGAGGCTGG + Intergenic
1122597064 14:102901145-102901167 ACAGCAGGGGCCCCCGAGTCAGG - Intronic
1123053425 14:105558804-105558826 CCAGCAGGGACCCCAGAGACCGG - Intergenic
1123057187 14:105576065-105576087 ACAGAAGGGTGGCCAGAGACAGG - Intergenic
1123078002 14:105679218-105679240 CCAGCAGGGACCCCAGAGACCGG - Intergenic
1123081057 14:105695826-105695848 ACAGAAGGGTAGCCAGAGACAGG + Intergenic
1125486164 15:40112345-40112367 GGAGAAGGGTCCCCAGAGAAAGG + Intergenic
1127450353 15:59110472-59110494 CCAGAAGGCTGACCAGAGACAGG - Intronic
1128454027 15:67822893-67822915 CCAGTAGGGTCACCAGAGACCGG - Intronic
1129222476 15:74139324-74139346 ACAGAATGGTCCCCAGCCTCTGG + Intergenic
1129342208 15:74893381-74893403 TGAGAACTGTCCCCAGAGTCTGG - Intronic
1129834470 15:78693360-78693382 GAACCAGGGTCCCCAGAGTCTGG - Intronic
1129847307 15:78773916-78773938 CTGGAAGGGTCCCCAGTGCCAGG + Intronic
1130354578 15:83117694-83117716 ACAGCTGGGTCCCCAGAGCCTGG - Intronic
1132212626 15:100035684-100035706 CCAGAGGGACCCCCAGAGACTGG + Intronic
1132660173 16:1057751-1057773 CCTCGAGGGTCCCCAGGGTCGGG + Intergenic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1134051260 16:11139176-11139198 CTAGAAGGGTCCCCAGGAACTGG + Intronic
1134569994 16:15282820-15282842 CCAGAAGGACCCACAGAATCAGG + Intergenic
1134732384 16:16473230-16473252 CCAGAAGGACCCACAGAATCAGG - Intergenic
1134935054 16:18238734-18238756 CCAGAAGGACCCACAGAATCAGG + Intergenic
1135353736 16:21752182-21752204 CCAGAAAGGTGCCAAGTGTCAGG - Intronic
1135452225 16:22568310-22568332 CCAGAAAGGTGCCAAGTGTCAGG - Intergenic
1136282855 16:29224073-29224095 CTTGAAAGTTCCCCAGAGTCTGG - Intergenic
1136513069 16:30750994-30751016 CCAGATGGGTCTTCAGAGTCTGG + Intronic
1137399683 16:48143276-48143298 CCAGAAGGGTCCTGAGCCTCAGG + Intronic
1138530494 16:57631811-57631833 CCAGATGGGGCACCAGAGACAGG - Intronic
1139965432 16:70742525-70742547 CCAGCAGGGGTCCCAGGGTCAGG + Intronic
1140410179 16:74736533-74736555 CCACCAGGGTCCCCAGGGCCTGG - Intronic
1141540146 16:84713844-84713866 CCAGCAGGGTCCCAAGAGAAGGG + Intronic
1141568335 16:84918586-84918608 ACAGAGTGGTTCCCAGAGTCAGG + Intronic
1141746642 16:85930721-85930743 CAAGGAGGGTCCCCAAAGCCTGG + Intergenic
1142087232 16:88189969-88189991 CTTGAAAGTTCCCCAGAGTCTGG - Intergenic
1142160743 16:88556128-88556150 CCAAAGGGTTCCCCAGAGTGTGG + Intergenic
1142429020 16:90016485-90016507 CCAGGAAGGACCCCAGAGTGTGG + Intronic
1142559880 17:803579-803601 CCTGAAAGGACCCCAGGGTCAGG - Intronic
1142576642 17:913380-913402 CAAAAAGGGTTCCCAGACTCTGG - Intronic
1143332978 17:6151344-6151366 CAAGATGGGTCCCCATAGACAGG - Intergenic
1143492419 17:7292214-7292236 CCAGCAGGGCCCCCAGAAGCTGG + Intronic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1144359180 17:14475533-14475555 CCCCCAGGGTCCCCATAGTCTGG + Intergenic
1144664877 17:17095650-17095672 CTAGGAGGGCCCCTAGAGTCAGG - Intronic
1144703005 17:17350935-17350957 TCAGCAGGGTCCCCAGGGTGGGG - Intergenic
1146263092 17:31434218-31434240 CAAGAAGGGTCCTCAGAGGGAGG - Intronic
1147333994 17:39716037-39716059 CAAGAAGGGTGCACAGAGACGGG - Intronic
1148326559 17:46786436-46786458 CCAGAGGGGTGTCCAGAGACGGG + Intronic
1148737232 17:49871616-49871638 ACAGAAGGGTCCCCCAGGTCAGG - Intergenic
1151112981 17:71701437-71701459 CCACAACAGTCCCCAGAGTGTGG - Intergenic
1151306132 17:73263645-73263667 CCAGCAGGCCCCCCAGAGTTGGG - Intergenic
1151514171 17:74581463-74581485 CCAGAGGAGTCCCCAGAGGTCGG - Intronic
1151696976 17:75722688-75722710 CCAGAGGGGTCCCCAGGGGTTGG + Intronic
1152246282 17:79186409-79186431 CCGGTGGGGTCCGCAGAGTCAGG - Intronic
1152604928 17:81284784-81284806 CCGGGAGGGTCCCCAGTGTCTGG + Intronic
1152633853 17:81422611-81422633 ACAGCAGGGTCCCCCAAGTCCGG + Intronic
1154485507 18:14868608-14868630 CCCAAAGGGTGCCCAGAGGCAGG - Intergenic
1156160303 18:34350963-34350985 CCAGAGGGGAGCCCAAAGTCAGG - Intergenic
1156653611 18:39256567-39256589 CCACAACAGTCCCCAGAGTGTGG - Intergenic
1157975480 18:52322541-52322563 ACAGAATTGGCCCCAGAGTCTGG - Intergenic
1158040447 18:53086762-53086784 CCACAACAGTCCCCAGAGTGTGG + Intronic
1159010861 18:63057734-63057756 CCCCCAGGGACCCCAGAGTCTGG + Intergenic
1159786582 18:72722014-72722036 CCAGAGGGGTCCACAGATGCAGG + Intergenic
1161067792 19:2247146-2247168 CCAGAAGGGTCTGCACAGGCCGG + Intronic
1161273914 19:3404886-3404908 CCCCAGGGGTCCCCAGAGGCGGG + Intronic
1161596974 19:5155471-5155493 TCAGCAGTGTCCCCAGAGCCTGG - Intergenic
1161868024 19:6848885-6848907 CTAGGAGGGTCCCCTGAATCTGG - Intronic
1162386642 19:10364138-10364160 CCTGAATGGTCACCAGCGTCAGG + Intronic
1163329764 19:16628667-16628689 GCAGAAGGGTCATCGGAGTCCGG + Intronic
1163460852 19:17436642-17436664 CCAAAGGGGTCCCCAGGCTCTGG + Exonic
1163821202 19:19497596-19497618 CAAGAAAGGTTCCCAGAGACCGG - Intronic
1165245036 19:34493864-34493886 CCAGGAGGGTCCCCTGTGCCAGG - Intronic
1165477150 19:36037547-36037569 CCAGTAGTGTGCCCACAGTCAGG - Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1166993351 19:46706313-46706335 CCAGAAGGGCTCCCAAAGGCTGG - Intronic
925060422 2:885977-885999 CCTGAAGGAGCCCCAGACTCAGG + Intergenic
929155792 2:38787478-38787500 CCAGAAGGGTCTGAAGAGTATGG - Intergenic
930021269 2:47003598-47003620 GCAGGAGGGTCCCCAGACCCTGG + Intronic
932627957 2:73314006-73314028 TCAGAATGGACCCCAGAATCTGG + Intergenic
932955358 2:76345314-76345336 CCAGGACAGTCCCCAGAGTGTGG + Intergenic
936010027 2:108919699-108919721 CGAGAAGGCACCCCAGAGCCTGG - Intronic
937431355 2:121841422-121841444 CCAGATGGGTCACCAGAGTCTGG - Intergenic
938099218 2:128486724-128486746 GCAGACAGCTCCCCAGAGTCAGG - Intergenic
938770619 2:134498121-134498143 CTAAGAGGGGCCCCAGAGTCAGG + Intronic
943970207 2:194394677-194394699 CCACAACAGTCCCCAGAGTGTGG - Intergenic
946399725 2:219461941-219461963 CCAGAGGAGTTCCCAGAGCCTGG + Exonic
946710460 2:222499883-222499905 GCAGAAGGGCCCAAAGAGTCAGG + Intronic
948185603 2:236019205-236019227 CCAGCAGGGACCTGAGAGTCGGG - Intronic
1171119719 20:22557925-22557947 CCTGGGGGGTCCCCAAAGTCGGG + Intergenic
1171405071 20:24906441-24906463 CCACAACAGTCCCCAGAGTGTGG - Intergenic
1172112867 20:32557686-32557708 CCAGAAGGTTCCCCTGTGACTGG - Intronic
1173271862 20:41543658-41543680 CCAGAAGGGTCCCAAGATGAGGG + Intronic
1173960316 20:47066236-47066258 GTAGGAGGGTCACCAGAGTCTGG + Intronic
1174146695 20:48456930-48456952 CCAAAGGGCTCCCCAGAGACTGG - Intergenic
1174453956 20:50636706-50636728 CCAGGACAGTCCCCAGTGTCTGG - Intronic
1175544584 20:59770149-59770171 CCAGAAGTGTCCGCAGACTGGGG - Intronic
1175690990 20:61065916-61065938 GCAGAAGAGTCCCCAGAGATAGG + Intergenic
1175831794 20:61968633-61968655 CCAGGAGGCTCCCCAGGGTCCGG + Intronic
1176115660 20:63430901-63430923 CCAGATGGGTGCCCAGCGCCAGG + Intronic
1176241375 20:64077293-64077315 CCAAAGGGGCCCCGAGAGTCTGG + Intronic
1176795829 21:13370869-13370891 CCCAAAGGGTGCCCAGAGGCAGG + Intergenic
1177253361 21:18625789-18625811 CCACAACAGTCCCCAGAGTGTGG + Intergenic
1178920365 21:36734759-36734781 CAAGCAGGGTCTTCAGAGTCGGG + Intronic
1178920404 21:36734929-36734951 CCAGAAGCTGCCCCAGAGCCTGG + Intronic
1179160622 21:38894113-38894135 CTAGAAGAGTTTCCAGAGTCTGG + Intergenic
1179722059 21:43321633-43321655 CCAGAAGGGCCCCCAAAGAGAGG - Intergenic
1180289510 22:10784099-10784121 CCCAAAGGGTGCCCAGAGGCAGG + Intergenic
1180305389 22:11068700-11068722 CCCAAAGGGTGCCCAGAGGCAGG - Intergenic
1181558999 22:23688864-23688886 ACAGAAGGGTCTCCACAGACAGG + Intronic
949150405 3:760113-760135 CCACAACAGTCCCCAGAGTGTGG + Intergenic
950187222 3:10952594-10952616 TCAGGAGGATCCCCAGAGTTGGG - Intergenic
950486432 3:13276646-13276668 CCTGCAGGGTCCCCAGAGCAAGG + Intergenic
951520827 3:23609375-23609397 CCTGCAGAGCCCCCAGAGTCTGG - Intergenic
951943913 3:28112817-28112839 CCAGAATTTTTCCCAGAGTCAGG + Intergenic
952425523 3:33170723-33170745 CCAGCAGGCTTCCCAGATTCTGG - Intronic
954645024 3:52125971-52125993 CCAGAAAGGTGCTCAGAGTAAGG + Intronic
958412824 3:93838228-93838250 CCACAACTGTCCCCAGAGTGTGG - Intergenic
961826461 3:129601729-129601751 GCAGAAAGCTGCCCAGAGTCAGG - Intronic
962533210 3:136302725-136302747 CCACAACAGTCCCCAGAGTGTGG + Intronic
964256523 3:154780744-154780766 CCAGAAGGGATCCCAGAGTTTGG + Intergenic
967428493 3:189354770-189354792 CCAGAAACATCCCCATAGTCTGG + Intergenic
967440752 3:189505623-189505645 CCTGAAGGGTTCCCAAAATCAGG - Intergenic
967976233 3:195036104-195036126 ACAGGGGGGTCCCCAGAGTAAGG + Intergenic
968271645 3:197407722-197407744 GCAGATGGCTCCCCAGGGTCTGG + Intergenic
969787885 4:9473585-9473607 CCATGGGGGTCCCAAGAGTCAGG - Intergenic
974831884 4:67199895-67199917 CCAGAGGGATCCCCAGATGCGGG + Intergenic
974834840 4:67235926-67235948 CCAGCTGGGTCCCAAGAGCCAGG + Intergenic
976049477 4:80994636-80994658 CCACAACAGTCCCCAGAGTGTGG + Intergenic
976874513 4:89837131-89837153 CCAGAAGGGGCCCAAGAGAGGGG - Intronic
977606450 4:98989502-98989524 GCAGAAGGATCGCCTGAGTCTGG - Intergenic
979227807 4:118309661-118309683 CTAGAAGGGTCTCCAGCTTCAGG + Intronic
979366805 4:119834865-119834887 TCAGAAGGGATCCCAGACTCTGG + Intergenic
979929911 4:126617400-126617422 CCAGAATGGTGCCCACAGACTGG - Intergenic
980540923 4:134193745-134193767 CCACAAGGGTCCCTAGAGAGAGG + Intergenic
980795278 4:137674580-137674602 CCACAACAGTCCCCAGAGTGTGG + Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
985160442 4:187038860-187038882 GCAACAGGGTCCCCAGATTCAGG - Intergenic
985879205 5:2625699-2625721 CCAGAAGTGTCCTCTGAGACAGG - Intergenic
986071727 5:4291807-4291829 CCAGAAGGGTCAGCAAAGTCAGG - Intergenic
989965578 5:50462637-50462659 ACAGAAGGGTCTATAGAGTCAGG + Intergenic
991003436 5:61805416-61805438 CAAGAAGGATCTCCAGATTCAGG + Intergenic
991885604 5:71264073-71264095 CCACAACAGTCCCCAGAGTGTGG + Intergenic
995548023 5:113252224-113252246 CCACAAGGGTCCCCAGCCCCCGG + Intronic
999085606 5:148886127-148886149 CCAAAAGTGTCCCCAAAGCCAGG - Intergenic
999210267 5:149882183-149882205 CCACAAAGGTCCCCTGATTCTGG - Intronic
1002079203 5:176727637-176727659 CCAGAATCGTCCCCAGCGGCAGG - Intergenic
1002724291 5:181284044-181284066 CCCAAAGGGTGCCCAGAGGCAGG - Intergenic
1005206983 6:23415789-23415811 CAAGCAGAGGCCCCAGAGTCAGG + Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1010010313 6:71041050-71041072 TTACAAGGGTCCCCAGAGACAGG - Intergenic
1020870360 7:13621810-13621832 CCACAACAGTCCCCAGAGTGTGG - Intergenic
1021103120 7:16606333-16606355 GCAGAAGGATCACCTGAGTCCGG + Intronic
1021896319 7:25239521-25239543 TCAGAAGGCTCCCCAGAGAGGGG - Intergenic
1023450356 7:40277849-40277871 CCACAACAGTCCCCAGAGTGTGG + Intronic
1025940961 7:66075982-66076004 CCAGCAGGGTCCCCCGGGCCGGG - Intronic
1026881409 7:73908965-73908987 TCAGGAGGGTCCCCAAAGACAGG - Intergenic
1027551164 7:79597775-79597797 ACAGCAGGGTGCCCAGAGTTGGG + Intergenic
1027819937 7:83029941-83029963 CCACAACAGTCCCCAGAGTGTGG - Intronic
1029392748 7:100286454-100286476 CCAGCAGCTTCCCCAGTGTCTGG - Intergenic
1034317956 7:150151716-150151738 CCACAACAGTCCCCAGAGTGTGG - Intergenic
1034815356 7:154167603-154167625 CCAGAAGGGTCTGCAGATACTGG - Intronic
1035070786 7:156143736-156143758 AAGGAAGGGTCCCCAGAGGCAGG + Intergenic
1035810275 8:2485632-2485654 CCAGCAGGGTGCCCCGAGGCAGG - Intergenic
1036683932 8:10895702-10895724 CCCGAGGGGACCCCCGAGTCAGG + Intergenic
1037855412 8:22367647-22367669 GCAGAAGGGTGCCCAGAGCGTGG + Intronic
1037988249 8:23303004-23303026 GGAGCAGGGTCCCCAGAGTCTGG + Intronic
1038623117 8:29163747-29163769 CCAGAAGGGACCCCTGAGAGAGG + Intronic
1038798271 8:30727961-30727983 CCAGGAGGATGCCCAGAGGCGGG + Intergenic
1039967126 8:42291543-42291565 CCAGAAGGGTCACAATAGTGGGG + Intronic
1040559755 8:48514157-48514179 CCAGAAGGAGCCCCAGAGAGTGG - Intergenic
1041024256 8:53667803-53667825 GCAGAATGGTCCCCAGAGGTGGG + Intergenic
1043076337 8:75706197-75706219 CCACAATGGTCCCCTGACTCAGG + Intergenic
1049571001 8:143370293-143370315 CCAGAAATGACCCCACAGTCAGG + Intronic
1049877445 8:145034396-145034418 CCACAACAGTCCCCAGAGTGTGG - Intergenic
1050405902 9:5308577-5308599 TCACAAGGGACCCCAGAGCCCGG + Intergenic
1051335756 9:16064505-16064527 GCAGATGGGACCCCAGAGTCAGG - Intergenic
1052831039 9:33216041-33216063 GCAGAAGGGTCCCTTGAGTTTGG - Intergenic
1053456199 9:38234747-38234769 CCAGGAGGGTCCCCTGGGACTGG - Intergenic
1053886427 9:42647477-42647499 CCCAAAGGGTGCCCAGAGGCAGG - Intergenic
1054225446 9:62454926-62454948 CCCAAAGGGTGCCCAGAGGCAGG - Intergenic
1055485954 9:76756638-76756660 CCAGGAGGATTCCCTGAGTCTGG + Intronic
1056538582 9:87552158-87552180 CCAGTAGGGAGCCCAGAGCCTGG + Intronic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1056753580 9:89368482-89368504 CCAGAAGGGTCCCCAGAGTCTGG - Intronic
1056819125 9:89824623-89824645 CCAGAACGTACCCCAGAGACTGG + Intergenic
1057539948 9:95958038-95958060 CCACAACAGTCCCCAGAGTGTGG + Intronic
1057828933 9:98392504-98392526 CCAGAATGGTCTCCACACTCAGG - Intronic
1059496038 9:114710323-114710345 GCAGAAGGATCACCTGAGTCTGG - Intergenic
1060998029 9:127885997-127886019 GCAGAAGGGTGCCCAGAGAGGGG + Exonic
1061412174 9:130427677-130427699 GCAGAAGGGTCCCCAGGGCCAGG + Intronic
1061954591 9:133955231-133955253 CCTGTGGGGTCCCCAGAATCTGG - Intronic
1185591896 X:1282830-1282852 CCAGATGGGTCTCCAGATGCAGG - Intronic
1187271868 X:17787530-17787552 CCAGAAGGGTCACCAGAACCTGG + Intergenic
1188625909 X:32284925-32284947 CCAGAAAAGTCCTCAGAGTTGGG + Intronic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1192696290 X:73419410-73419432 CCACAACAGTCCCCAGAGTGTGG + Intergenic
1192848032 X:74925625-74925647 TCAGAAAGGTGCCCAGAGTGGGG + Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1196051812 X:111313543-111313565 CCAAAATGGTAGCCAGAGTCAGG + Intronic
1198441566 X:136668328-136668350 CCAAAAGGTTTCCCAGAGACAGG - Intronic
1199036150 X:143053156-143053178 CCAGAAGGGAGCCCACTGTCTGG - Intergenic
1199432841 X:147780140-147780162 CCACAAGCCACCCCAGAGTCTGG + Intergenic
1200072228 X:153534960-153534982 CCAGGAGCTTCCCCAGAGACGGG + Intronic
1201192088 Y:11453101-11453123 CCAGCATGGTCCCCAGAGCGTGG - Intergenic
1201936165 Y:19412821-19412843 CCACAACAGTCCCCAGAGTGTGG + Intergenic