ID: 1056756490

View in Genome Browser
Species Human (GRCh38)
Location 9:89385174-89385196
Sequence CCTCAAAGGCAGAAGGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 403}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056756490_1056756503 17 Left 1056756490 9:89385174-89385196 CCTACCCCCTTCTGCCTTTGAGG 0: 1
1: 0
2: 1
3: 35
4: 403
Right 1056756503 9:89385214-89385236 CTGGAAGCCTCCACCAGCCTGGG No data
1056756490_1056756502 16 Left 1056756490 9:89385174-89385196 CCTACCCCCTTCTGCCTTTGAGG 0: 1
1: 0
2: 1
3: 35
4: 403
Right 1056756502 9:89385213-89385235 CCTGGAAGCCTCCACCAGCCTGG No data
1056756490_1056756497 -2 Left 1056756490 9:89385174-89385196 CCTACCCCCTTCTGCCTTTGAGG 0: 1
1: 0
2: 1
3: 35
4: 403
Right 1056756497 9:89385195-89385217 GGATCAGTGCCCATGTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056756490 Original CRISPR CCTCAAAGGCAGAAGGGGGT AGG (reversed) Intronic
901652109 1:10748950-10748972 CCCCAAAGACAGAAGCGAGTTGG - Intronic
902225841 1:14996060-14996082 CTCCAGAGGCAGAAGGGGCTGGG - Intronic
903001325 1:20268109-20268131 CCTCAAAGGCTGCAGGGGGAGGG - Intergenic
903236760 1:21955632-21955654 CTTCAGAGCCAGAAGGGGCTGGG + Intergenic
904403997 1:30274521-30274543 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
904475432 1:30761965-30761987 CCTCAAAGGCAGAAGTGAGGTGG - Intergenic
904936932 1:34137555-34137577 GTTCAAAGGCAGAAGGGTGAAGG - Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905889254 1:41509491-41509513 CCACAAAGGCAGAAGTGGCAGGG - Exonic
906248412 1:44293198-44293220 CTTCAATGGCAGAAAGGGGTGGG + Intronic
906788895 1:48641511-48641533 CTTCAAAGGCAGAAGGACTTGGG + Intronic
907369651 1:53992657-53992679 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
907748914 1:57243588-57243610 CCTGGAAGTCAGAAGTGGGTTGG - Intronic
907826473 1:58021896-58021918 GTTCAGAAGCAGAAGGGGGTTGG + Intronic
908326680 1:63029999-63030021 CCTCAATGGGAGAAGAGGGATGG - Intergenic
909384747 1:75041604-75041626 CCTAAAAGCCAGAAGAGAGTAGG + Intergenic
909558544 1:76982825-76982847 CCTAAAAGCCAGAAGAGAGTGGG + Intronic
911145316 1:94546793-94546815 CATCAAAGGCAGCAAGGGATTGG - Intergenic
911300825 1:96171559-96171581 ACTCAAATGGAGAAGGGGGTAGG - Intergenic
911700617 1:100948370-100948392 CCTAAAAGCCAGAAGAGAGTGGG - Intronic
912062288 1:105687511-105687533 CCTCAAACTCAGAAGCAGGTGGG + Intergenic
913225239 1:116693345-116693367 CCTCAGAGGGTGAAGGGGGGAGG - Intergenic
917512845 1:175682539-175682561 CCACAAGGGCAGAAGATGGTGGG - Intronic
917547412 1:175984959-175984981 ACTCATAGGCAGAAGGGACTTGG + Intronic
918452268 1:184670882-184670904 CCTCAAAAGCAGGAAGGGTTGGG - Intergenic
918624240 1:186639007-186639029 CCTACAAGCCAGAAGGGAGTGGG + Intergenic
919146583 1:193643717-193643739 CCTACAAGCCAGAAGAGGGTGGG - Intergenic
919350075 1:196440102-196440124 CCTCAAGGGTAGACAGGGGTAGG - Intronic
919476934 1:198040870-198040892 CAGCAAAGGCAGATAGGGGTGGG - Intergenic
919513468 1:198494250-198494272 GCTCCTGGGCAGAAGGGGGTTGG - Intergenic
920091339 1:203455286-203455308 CCTCAGAGGCAGATGAGGGCTGG - Intergenic
920205324 1:204286987-204287009 GCTGAAAGCCACAAGGGGGTTGG + Intronic
920418017 1:205811726-205811748 TCTCAAGGGCAGGAGTGGGTAGG - Intronic
922200809 1:223399862-223399884 CCTACAAGCCAGAAGGGAGTGGG - Intergenic
923109686 1:230880586-230880608 ACCCAAAGGGAGAAGGGGATGGG - Intergenic
923545938 1:234923296-234923318 CGTCAAAAGCAGCAGGTGGTTGG - Intergenic
923780947 1:237023799-237023821 CCTACAAGCCAGAAGGGAGTGGG - Intergenic
924368356 1:243320528-243320550 CGTCAAAGGCAGGAGGGCTTAGG + Intronic
924613979 1:245597453-245597475 CCTACAAGCCAGAAGAGGGTGGG - Intronic
1062946466 10:1465457-1465479 CCTCCGAGGCACCAGGGGGTCGG + Intronic
1064492697 10:15876845-15876867 CCTACAAGGCAGAAGAGAGTGGG - Intergenic
1064789297 10:18937848-18937870 CCTACAAGCCAGAAGGGAGTGGG - Intergenic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1066300990 10:34095609-34095631 CTTGAAAGCCAGAAGGGAGTGGG + Intergenic
1066664367 10:37767437-37767459 CCTACAAGCCAGAAGGGAGTGGG + Intergenic
1067360769 10:45575965-45575987 CAGCAAAGGGAGAAAGGGGTGGG - Intronic
1068213579 10:53953048-53953070 CCTCCAACTCAGAAGTGGGTGGG + Intronic
1068567803 10:58594538-58594560 CCTACAAGCCAGAAGAGGGTAGG + Intronic
1068714738 10:60175754-60175776 CCTCAGAGGCAGACTGGGTTTGG + Intronic
1068715062 10:60178904-60178926 CTTCAAATGCAAAAGGGGGGTGG + Intronic
1069264098 10:66437016-66437038 CCTACAAGCCAGAAGAGGGTGGG - Intronic
1069859641 10:71462359-71462381 CCTCTAAAGCAGATGGCGGTGGG - Intronic
1070852029 10:79572174-79572196 CCTTCAAGCCAGAAGGGAGTGGG + Intergenic
1071497418 10:86178710-86178732 TCTCAAAGGCAGAAAGGGCCAGG - Intronic
1071844515 10:89507387-89507409 CCTACAAGCCAGAAGGGAGTGGG + Intronic
1071998703 10:91172625-91172647 CCTCAATGGCAAAAAGGTGTTGG + Intronic
1072565384 10:96612709-96612731 CATCAAAGGCTGATGGGGGCTGG + Intronic
1076185332 10:128442193-128442215 CCTACAAGGCAGAAGAGAGTGGG + Intergenic
1077967270 11:7148335-7148357 CCTACAAGCCAGAAGGGAGTGGG - Intergenic
1078697932 11:13653061-13653083 CCTAAAAGCCAGAAGAGAGTGGG + Intergenic
1079426254 11:20344488-20344510 CCTACAAGCCAGAAGAGGGTTGG + Intergenic
1081743995 11:45460282-45460304 CCTCCAAGGCAAAATGGAGTAGG + Intergenic
1082249777 11:49965284-49965306 CCTACAAGCCAGAAGAGGGTGGG + Intergenic
1082561201 11:54623067-54623089 CCTACAAGCCAGAAGAGGGTGGG - Intergenic
1083166711 11:60892978-60893000 CCTGAACTGCAGAAGGGAGTAGG - Intronic
1083649404 11:64192668-64192690 CCTCACAGGAAGAAGGTGGGCGG - Intronic
1087127481 11:94641888-94641910 CAGCAAAGGCAGATAGGGGTGGG - Intergenic
1087128288 11:94647190-94647212 CAGCAAAGGCAGATAGGGGTGGG - Intergenic
1088151974 11:106756675-106756697 CCTAAAAGCCAGAAGAGAGTGGG - Intronic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088711233 11:112510811-112510833 CATCAAAGGCAGAAGTGGTGTGG + Intergenic
1091137486 11:133205102-133205124 CCTCCCAGGAAGAAGAGGGTGGG - Intronic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1092878968 12:12873078-12873100 CTTCAAAGGGAGTAGAGGGTGGG - Intergenic
1092945407 12:13449815-13449837 GGGCAGAGGCAGAAGGGGGTGGG - Intergenic
1093684382 12:22039815-22039837 CATCAAAGGATGAAGAGGGTGGG - Intergenic
1094781879 12:33801184-33801206 CCTAAAAGCCAGAAGAGAGTGGG - Intergenic
1095603169 12:44037516-44037538 GCTCCTAGGCAGAAAGGGGTGGG + Intronic
1095793631 12:46194262-46194284 CCTACAAGCCAGAAGGGAGTGGG - Intronic
1096321741 12:50620216-50620238 CCTAAAAGCCACAAGGTGGTAGG - Intronic
1096791232 12:54046511-54046533 CCTCAAGGAGAGAAGGGGATTGG - Intronic
1096956611 12:55532446-55532468 CCTGAAAGCCAGAAGGGATTGGG + Intergenic
1097989263 12:65817978-65818000 GCTTAAAGGCAGTTGGGGGTGGG + Intergenic
1098085726 12:66840761-66840783 CCTGAGAGGCAGAAGAGAGTAGG + Intergenic
1099205448 12:79721385-79721407 CAGAAAAGGCAGAAGGGGCTAGG - Intergenic
1099487848 12:83249976-83249998 GCTCATAGGCAGAAGGGACTTGG + Intergenic
1100790483 12:98124857-98124879 CCTCAAAAGCAGAGGCAGGTAGG + Intergenic
1101408708 12:104452144-104452166 CCTCCCAGGCAAAAGGGGGCAGG + Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1103408894 12:120696516-120696538 CGGCAGAGGCAGAAGAGGGTTGG - Exonic
1104223671 12:126810655-126810677 CCTGGAAGACTGAAGGGGGTGGG + Intergenic
1104889647 12:132134199-132134221 CCTCTACGGAGGAAGGGGGTAGG - Intergenic
1106240711 13:27910757-27910779 CCTAAAAAGCAGCAGGGAGTGGG - Intergenic
1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG + Intergenic
1107473273 13:40711195-40711217 CCTACAAGCCAGAAGGGAGTGGG - Intergenic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1110263102 13:73508281-73508303 GCTCAAAGGCTGAAGGAGCTGGG - Intergenic
1111800497 13:92974834-92974856 ATTCATGGGCAGAAGGGGGTGGG - Intergenic
1112489374 13:99848175-99848197 CCTCAAGCTGAGAAGGGGGTTGG - Intronic
1113667319 13:112149732-112149754 CCTCACAGGGGGAAGGTGGTGGG - Intergenic
1114490470 14:23097916-23097938 ACTCAAAGATAGAAGGTGGTCGG - Exonic
1114677345 14:24452213-24452235 TCTCAAAGCCAGAAGAGAGTGGG - Intergenic
1115162146 14:30408795-30408817 CCTAAAAGCCAGAAGAGAGTGGG - Intergenic
1115643053 14:35347574-35347596 GATCAAAGGGAGGAGGGGGTGGG + Intergenic
1115753564 14:36513640-36513662 CCTCAAGGCCAGGAGGGGGGTGG - Exonic
1116083496 14:40204987-40205009 CCTCCAACTCAGAAGGGGGCGGG + Intergenic
1116417345 14:44694716-44694738 CCTACAAGCCAGAAGGGAGTGGG + Intergenic
1116792334 14:49352887-49352909 CCTACAAGGCAGAAGAGAGTGGG - Intergenic
1116792899 14:49358390-49358412 CCTACAAGGCAGAAGAGAGTGGG + Intergenic
1118029781 14:61808830-61808852 CCAACAAGGAAGAAGGGGGTGGG - Intergenic
1118377723 14:65191579-65191601 CCTCAAGGGCAAAAGGAGGAAGG + Intergenic
1119582508 14:75799794-75799816 CCTAAAAGCTAGAAGGGAGTGGG - Intronic
1120186621 14:81400319-81400341 CGTCAAAGGCAGAAGCCAGTGGG - Intronic
1120748486 14:88175114-88175136 CCACCAAGGCAGAAAGAGGTTGG + Intergenic
1121052996 14:90831515-90831537 CCGCAAAGGCAGCAGGGGCGGGG - Intergenic
1122057949 14:99117861-99117883 CCTCAAAGGCAGCAAGGGGACGG - Intergenic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1122232417 14:100313346-100313368 CCTCAGAGGCTGAAGGGCTTGGG + Intergenic
1123066537 14:105622090-105622112 CCTGAAAGGCAGATGGGCCTTGG - Intergenic
1124885835 15:33684764-33684786 CCTGCAAGCCAGAAGAGGGTGGG + Intronic
1124894151 15:33759954-33759976 CCTATAAGCCAGAAGAGGGTGGG + Intronic
1124964401 15:34422632-34422654 CCCCAGAGTCAGAAGGGGGTTGG + Intronic
1124981020 15:34568860-34568882 CCCCAGAGTCAGAAGGGGGTTGG + Intronic
1127885330 15:63194079-63194101 CCTAACAGGAAGAAGGGGGCAGG - Intronic
1127931186 15:63598578-63598600 CCTCAAAGGCAGCACGGGACTGG - Intronic
1128215881 15:65933721-65933743 CCTGAAAGGCAGCAGGGGTGAGG + Intronic
1129032521 15:72629303-72629325 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129137794 15:73569869-73569891 CCTGAAAGGCAGATGGGACTAGG + Intronic
1129338721 15:74871138-74871160 GCTGAAAGGCAGAAAGGTGTGGG + Intronic
1129407291 15:75328051-75328073 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129470477 15:75750914-75750936 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129588140 15:76888990-76889012 CCTACAAGGCAGAAGAGAGTAGG + Intronic
1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG + Intergenic
1129841064 15:78743767-78743789 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1130800760 15:87261107-87261129 CCTAAAAGCCAGAAGAGAGTGGG - Intergenic
1131072429 15:89474660-89474682 CCTCAACTGCTGAAAGGGGTGGG + Intronic
1132600926 16:772644-772666 CCTCCGAGGCAGTGGGGGGTTGG + Intronic
1133115317 16:3575247-3575269 CCCCAAAGGCTGATGGGGGCTGG + Intronic
1133924867 16:10183909-10183931 CCTGAAAGGCAGACAGGCGTTGG - Intergenic
1137469731 16:48743564-48743586 CCTCAGTGACAGAAGGTGGTTGG - Intergenic
1137574076 16:49586914-49586936 CCTCCAAGGCAGCTGGGGCTGGG - Intronic
1137969803 16:52973907-52973929 CCTACAAGCCAGAAGAGGGTGGG - Intergenic
1138507537 16:57485828-57485850 CCCCATAGGCAGGAGGGGGTCGG + Intronic
1139717084 16:68822350-68822372 CCTCAAAGACAGAAGGGACAAGG - Intronic
1139939670 16:70596163-70596185 CCTCAGAGGCAGGAGGGGTGAGG + Intronic
1140103372 16:71938033-71938055 CCTCCAACTCAGAAGGGGGCAGG - Intronic
1140741746 16:77947754-77947776 CCTCAAAAACAGAGGGAGGTAGG - Intronic
1141693838 16:85611036-85611058 TCTCCAAGGAAGAAGGGAGTAGG + Intergenic
1142875340 17:2849083-2849105 CCTCAAAGGCAGAAGAGAGCGGG + Intronic
1144351733 17:14403255-14403277 GCTCATAGGCAGAAGGGACTTGG + Intergenic
1144704473 17:17358194-17358216 CCTTAAAGGCAGAAGAGGCTGGG + Intergenic
1144795695 17:17889596-17889618 CCTCACAGGCAGGAGGTGTTAGG + Intronic
1145006640 17:19342319-19342341 GATAAAAGGCAGAAGAGGGTCGG + Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1147139734 17:38454208-38454230 GCTCAAAGGCCGCAGGGAGTTGG - Intronic
1147316888 17:39625315-39625337 CCTGAAAGGAAGAAGGGGTATGG - Intergenic
1147915308 17:43882165-43882187 CCTCCAGGGAAGATGGGGGTGGG - Intronic
1147968481 17:44206948-44206970 CCGCAAGTGCAGAAGTGGGTGGG + Exonic
1148478339 17:47943711-47943733 CCTGAATGGCAGACGGGGCTTGG - Intronic
1148896590 17:50842584-50842606 ACACAAAGGCAGGAAGGGGTGGG + Intergenic
1150113791 17:62526493-62526515 TCTCAAAGGCAGATGGATGTGGG - Intronic
1150608468 17:66714219-66714241 CCCCAAAGGAAGCAGCGGGTGGG - Intronic
1151530765 17:74703313-74703335 CCTCATAGGCAGGTGGGGCTGGG + Intronic
1152692293 17:81724588-81724610 CCATAAAGTCAGAAGGGTGTGGG + Intergenic
1153064756 18:1033645-1033667 CCTCCAAGCCAGAAGAGAGTCGG - Intergenic
1153379984 18:4427602-4427624 ACTCAAAGACAGTAGGGAGTAGG + Intronic
1153428813 18:4993087-4993109 GCTCCTAGGCAGAAGGAGGTGGG - Intergenic
1153428905 18:4993521-4993543 CCACCAACGTAGAAGGGGGTGGG + Intergenic
1153915038 18:9737865-9737887 TTTTAAAAGCAGAAGGGGGTGGG - Intronic
1155162032 18:23203913-23203935 CCTCAGTGGCAGAAGGCGGCAGG + Intronic
1155167101 18:23240286-23240308 CCCCAAAGTAGGAAGGGGGTTGG + Intronic
1157404407 18:47410886-47410908 CCACACAGACAGGAGGGGGTTGG + Intergenic
1158023393 18:52869562-52869584 GCTCCTGGGCAGAAGGGGGTGGG - Intronic
1159766912 18:72502562-72502584 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
1161819689 19:6522266-6522288 CCTCAGAGGCAGAAGAAGGAGGG + Intergenic
1163137606 19:15324030-15324052 GGTCAAGGCCAGAAGGGGGTGGG + Intronic
1164644684 19:29849778-29849800 CCTCAAAGCCAGGTGGGGCTGGG - Intergenic
1166331237 19:42079154-42079176 ACCGAAAGGCAGAAGAGGGTGGG + Exonic
1166411381 19:42557666-42557688 CAGCAAAGGGAGATGGGGGTGGG - Intronic
1166897457 19:46032840-46032862 CCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1167646728 19:50710085-50710107 CCCCACAGGCAGATGGGGGTGGG - Intronic
1168506255 19:56937646-56937668 CTACAAAGGCAGGAGGGGCTGGG - Intergenic
927117376 2:19918055-19918077 CCTAAAAGCCAGAAGAGAGTGGG + Intronic
927183914 2:20468472-20468494 CCTCAAAGGCAGAACTGAGAAGG + Intergenic
927533879 2:23836999-23837021 GCTCCTGGGCAGAAGGGGGTGGG - Intronic
930359520 2:50359920-50359942 CCTCCAAGCCAGAAGAGAGTGGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931480585 2:62635087-62635109 CCTACAAGCCAGAAGGGAGTGGG + Intergenic
931864320 2:66392796-66392818 CCTGCAAGCCAGAAGGGAGTGGG + Intergenic
931886771 2:66626237-66626259 CCTCAGAAGCACAAGGGGTTGGG - Intergenic
932644766 2:73488549-73488571 CCTCCAACTCAGAAGGGAGTGGG + Intronic
932852521 2:75200520-75200542 CCTCAAAGTCAGAAGACGGCAGG - Intergenic
933646847 2:84820055-84820077 CCTCAAAAGCAGAGGTTGGTGGG + Intergenic
933736585 2:85500095-85500117 CCTCAAAAGCAGTAGGGGAGAGG - Intergenic
935961669 2:108431178-108431200 CCTAAAAGCCAGAAGAGAGTGGG + Intergenic
936932637 2:117805459-117805481 CCTGAAAGCCAGAAGAGAGTGGG + Intergenic
937289191 2:120771799-120771821 CCTCAAAGTTAGAAGGGGAGTGG + Intronic
937527605 2:122789464-122789486 GCTCATAGGCAGAAGGGCCTTGG + Intergenic
938072939 2:128317923-128317945 CCAAGAGGGCAGAAGGGGGTAGG + Intronic
939470848 2:142617519-142617541 CCTAAAAGCCAGAAGAGAGTGGG + Intergenic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
939876502 2:147584788-147584810 CCTACAAGCCAGAAGGGAGTAGG - Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940699606 2:157024290-157024312 CCTCATAGGCAGAAGGGACTTGG + Intergenic
941876341 2:170437370-170437392 GCTTCAAGGGAGAAGGGGGTGGG - Intronic
941915922 2:170813916-170813938 GCTCAAAGGCAGAAGAAGGAGGG - Intronic
942795497 2:179814148-179814170 CCTCAGGGGCAGAAGGGGCTGGG + Intronic
942873758 2:180766915-180766937 CCTAAAAGCCAGAAGAGAGTGGG + Intergenic
943130153 2:183843690-183843712 CCTCCATGGCAGAAGAGAGTGGG + Intergenic
943648835 2:190435062-190435084 CCTCAGATGGAGAGGGGGGTTGG - Intronic
943880585 2:193139902-193139924 GCTCACAGGCAGAAGGGGCTTGG - Intergenic
944868474 2:203885161-203885183 CCTCTAGAGCAGAAGGGGGTTGG + Intergenic
945481380 2:210349875-210349897 CCTACAAGCCAGAAGGGAGTGGG - Intergenic
945486695 2:210405561-210405583 CCTACAAGCCAGAAGGGAGTGGG - Intergenic
946287901 2:218719214-218719236 CCACGCTGGCAGAAGGGGGTGGG - Intronic
947637980 2:231689726-231689748 CCTCAGAGCCAGCAGGGGGGCGG - Intergenic
948981673 2:241497869-241497891 CCTCAGAGTCAGGAGAGGGTGGG - Intronic
948981681 2:241497902-241497924 CCTCAGAGTCAGGAGAGGGTGGG - Intronic
948981689 2:241497935-241497957 CCTCAGAGTCAGGAGAGGGTGGG - Intronic
948981696 2:241497968-241497990 CCTCAGAGTCAGGAGAGGGTGGG - Intronic
949009619 2:241671099-241671121 CCACCACGGCAGAGGGGGGTGGG - Intronic
1168851440 20:979750-979772 CCCCAAATGCAGAAGGAGCTGGG - Intronic
1168970363 20:1926735-1926757 CCTCACAGCCAGGAGGTGGTGGG + Intronic
1169010166 20:2243871-2243893 CCATAAAGGGAGAAGGGGATGGG + Intergenic
1169960153 20:11151111-11151133 CCTACAAGGCAGAAGAGAGTGGG - Intergenic
1171236923 20:23534938-23534960 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
1172931940 20:38592497-38592519 CAGCAAAGGGAGATGGGGGTGGG + Intergenic
1172977767 20:38919462-38919484 TGTCAAAGGCAGAAGGGTGTGGG + Exonic
1173208448 20:41013083-41013105 ACTCTAGGGCAGAGGGGGGTGGG + Intergenic
1174443416 20:50574347-50574369 CCTCATGGGGAGATGGGGGTGGG - Intronic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1174665633 20:52255293-52255315 TTTCAAAGGAAGAAAGGGGTTGG + Intergenic
1177235006 21:18377388-18377410 CATCAAACTCAGAAGGGGGAAGG + Intronic
1177992946 21:28059568-28059590 GCTCATAGGCAGAAGGGACTTGG + Intergenic
1179062075 21:37988530-37988552 CAGCAAAGGGAGATGGGGGTGGG - Intronic
1183273585 22:36877430-36877452 CCTAAAAGGGAGAAGAGGCTGGG - Intronic
1183311847 22:37114194-37114216 ACTCACAGTCAAAAGGGGGTGGG - Intergenic
1184834279 22:47011984-47012006 CCACCAAGGCAGAGCGGGGTGGG - Intronic
1184909317 22:47515959-47515981 CCTCAATGGCAGAAATGGGTAGG - Intergenic
1185315785 22:50178525-50178547 CCTCAAAGGGGGAAGGGAGGAGG + Intronic
949546812 3:5079924-5079946 CCGCAAGTGCAGAAGTGGGTGGG + Intergenic
950218760 3:11178606-11178628 TGTCAAAGGCCGCAGGGGGTGGG - Intronic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
952185147 3:30960672-30960694 GCTCATAGGCAGAAGGGACTTGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955414099 3:58676928-58676950 CCTAAAAGCCAGAAGAGAGTGGG - Intergenic
957723259 3:84031879-84031901 CCGCAATGGCAGTTGGGGGTGGG - Intergenic
958081273 3:88748713-88748735 CCTACAAGCCAGAAGGGAGTTGG + Intergenic
958404101 3:93730357-93730379 CCTACAAGCCAGAAGGGAGTGGG - Intergenic
958622037 3:96574613-96574635 CCTAAAAGCCAGAAGAGAGTAGG - Intergenic
958814649 3:98901879-98901901 CTCCAAAGGCCGAAGGGGATTGG - Intergenic
959278148 3:104304192-104304214 CCTGGGAGGCAGAAGGGGTTGGG + Intergenic
959500787 3:107103802-107103824 GCTCAAAAGCAGAAGGGGCCAGG - Intergenic
959801188 3:110496841-110496863 CCTAAAAGCCAGAAGAGAGTGGG + Intergenic
959924948 3:111910551-111910573 CCTCAAATGCAAACTGGGGTTGG - Intronic
961117392 3:124342307-124342329 CCGGAAAGGGAGAAGGGGCTGGG - Intronic
961516426 3:127440237-127440259 ACTCAGAGGCTGAAGGGGGCTGG + Intergenic
962866101 3:139449082-139449104 CCTCCTAGACAGAAGGGGATGGG + Intergenic
963420949 3:145060837-145060859 GCTCATAGGCAGAAGGGACTTGG - Intergenic
965100652 3:164293211-164293233 CCTACAAGCCAGAAGAGGGTGGG + Intergenic
965131306 3:164704284-164704306 CCTACAAGCCAGAAGAGGGTGGG + Intergenic
965474635 3:169140149-169140171 CCTGAAAGGCAGAGCAGGGTAGG - Intronic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968775277 4:2536506-2536528 CGTTAACGGCAGGAGGGGGTGGG + Intronic
968816347 4:2823743-2823765 CCTCATAGGCAGGAGGGGCTGGG - Intronic
969950128 4:10827628-10827650 CCTAAAAGCCAGAAGAGAGTGGG - Intergenic
970424385 4:15932976-15932998 CTTCAGAGGCAGAAAGGGCTTGG + Intergenic
971476153 4:27074567-27074589 CCTACAAGCCAGAAGGGAGTGGG - Intergenic
972341247 4:38154486-38154508 CCTGAAGGGCCGAAGGGGCTTGG - Intergenic
972780705 4:42284737-42284759 CCTCAGAAGCAGAAGAGGTTAGG - Intergenic
973562839 4:52153269-52153291 CCTACAAGCCAGAAGGGAGTGGG + Intergenic
973661119 4:53107039-53107061 CCTAAAAGCCAGAAGAGAGTGGG + Intronic
973857828 4:55031222-55031244 CGGCAAAGGCAAAAGGAGGTGGG - Intergenic
973993504 4:56435119-56435141 CCTAAAAGGCATAAGTGGCTGGG + Intronic
974425038 4:61731628-61731650 TCTCCAAGGCAGAAGTGGGAAGG - Intronic
975021989 4:69501747-69501769 CCTCAAAGGCAGGATTGGTTAGG - Intronic
975040884 4:69743547-69743569 GCTCCTGGGCAGAAGGGGGTGGG - Intronic
975513884 4:75223141-75223163 CCTAAAAGCCAGAAGAGAGTGGG + Intergenic
975524424 4:75333031-75333053 CCTACAAGGCAGAAGAGAGTGGG + Intergenic
976355987 4:84118215-84118237 CCTACAAGCCAGAAGAGGGTGGG - Intergenic
978051137 4:104201841-104201863 CCTAAAAGCCAGAAGAGAGTGGG - Intergenic
978055100 4:104253756-104253778 CCTACAAGGCAGAAGAGAGTGGG + Intergenic
978675316 4:111307897-111307919 CCTCACAGGCAGAAGAGAGTGGG - Intergenic
979461768 4:120991949-120991971 CCTGAAAGCCAGAAGGGATTGGG - Intergenic
980243106 4:130202315-130202337 GCTCATAGGCAGAAGGGGGTGGG + Intergenic
981131757 4:141164618-141164640 CCTAAAAGCCAGAAGAGAGTGGG + Intronic
981505690 4:145496816-145496838 CTTCAAAGGGAGAAAGTGGTAGG - Intronic
981760619 4:148191310-148191332 CCTCAAAGCTAGAAGGGATTAGG - Intronic
982292224 4:153791344-153791366 GCCCAAAAGCAGAAGGGAGTGGG - Intergenic
983125889 4:163950133-163950155 GCTCCCAGGCAGAAAGGGGTGGG - Intronic
983364478 4:166768515-166768537 TCTAAAAGGCAGAAGAGAGTGGG - Intronic
983633698 4:169876501-169876523 CCTTAAAAGCAGAATGGGGCCGG - Intergenic
984035427 4:174661793-174661815 CCTCAAAGGTAGAAAAGGGAAGG + Intronic
984447358 4:179853649-179853671 CTTCAAAGGCAGAAGCAGGTAGG + Intergenic
985984801 5:3505769-3505791 CCACAGAGACAGAAGGGGCTCGG - Intergenic
986472307 5:8088543-8088565 CCTACAAGGCAGAAGAGAGTGGG - Intergenic
986877342 5:12127464-12127486 CCTAAAAGCCAGAAGAGAGTGGG + Intergenic
987479246 5:18432164-18432186 CCTGAAAGCCAGAAGAGAGTGGG + Intergenic
988290002 5:29272140-29272162 CCTGCAAGCCAGAAGGGAGTGGG + Intergenic
988633176 5:32952771-32952793 ACTCAAAGGGTGTAGGGGGTGGG - Intergenic
990016206 5:51065199-51065221 CCTGAAAGCCAGAAGAGAGTGGG + Intergenic
990639236 5:57762833-57762855 CTGCAAAGGCAGTAGGGGGGTGG + Intergenic
990878641 5:60516904-60516926 CCTCACACTCAGAAGTGGGTGGG - Intronic
991161576 5:63509109-63509131 CCTACAAGCCAGAAGGGAGTGGG + Intergenic
993250734 5:85518971-85518993 GCTCAAAGACAGAAGCTGGTGGG - Intergenic
994199733 5:96959081-96959103 CTTAAAAGGCAGAAGAGGTTGGG - Intronic
995853880 5:116573732-116573754 CCTCGAGGGCTGGAGGGGGTTGG - Intronic
996234476 5:121108806-121108828 AGTCCTAGGCAGAAGGGGGTGGG - Intergenic
997182055 5:131840188-131840210 CCTAAAAGGCAGAAGAGATTGGG - Intronic
997475923 5:134142430-134142452 CCTCAGAAGTAGGAGGGGGTGGG + Intronic
997699134 5:135884185-135884207 ACTCAAAGGCAGGGGGTGGTTGG - Intronic
998003868 5:138644386-138644408 TCTCTAGGGCAGTAGGGGGTAGG + Intronic
998352879 5:141512567-141512589 ACCCAGGGGCAGAAGGGGGTGGG - Exonic
998483178 5:142479830-142479852 CTTCAAAGGAAGAGGGGGGCAGG + Intergenic
999210705 5:149886133-149886155 TCCCAAGGGCAGAAGGCGGTGGG + Intronic
999327518 5:150652209-150652231 CCTCAAGGGTAGAAGGGAGCAGG - Exonic
999758810 5:154684543-154684565 ACTCAAAGGCAGGAGGGTCTAGG - Intergenic
1000266257 5:159640995-159641017 GCTCCAGGGCAGAAAGGGGTGGG + Intergenic
1000412760 5:160950702-160950724 CCGCAAAAGCAGAGGGAGGTGGG - Intergenic
1002554102 5:180020780-180020802 ACACAGAGGCAGAAGGGGGGTGG + Intronic
1003568876 6:7242948-7242970 CCTCAAGGGCAGAGGGGGCCAGG - Intronic
1004737259 6:18419947-18419969 CCTGAAAGGCAGGAGGAGATGGG + Intronic
1005043507 6:21620558-21620580 ATTCCAGGGCAGAAGGGGGTGGG - Intergenic
1006287483 6:33107638-33107660 CCTCAAAGTCAGCTGGGGTTTGG - Intergenic
1006367112 6:33622124-33622146 CCTCAAAGGCACCACGGGATCGG - Intronic
1007082119 6:39115011-39115033 CCTGACTGGCAGCAGGGGGTTGG + Exonic
1008425029 6:51347647-51347669 CCTAAAAGCCAGAAGAGAGTGGG - Intergenic
1008758164 6:54823006-54823028 CCTCCAAGTCAGAAGAGAGTGGG - Intergenic
1008864172 6:56189782-56189804 CCTCAAAGCCAGAAGAGAGTGGG + Intronic
1009265919 6:61554836-61554858 CCTATAAGCCAGAAGGGGTTAGG - Intergenic
1011537558 6:88392517-88392539 TCTACAAGGCAGAAGGGAGTAGG + Intergenic
1012550731 6:100463247-100463269 TTTCAAAGGCAGAAGGGGCCGGG - Intronic
1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG + Intergenic
1013878096 6:114858506-114858528 CTACAGAGGAAGAAGGGGGTGGG + Intergenic
1014176845 6:118340869-118340891 CCTGCAAGCCAGAAGGGGGGTGG - Intergenic
1014584477 6:123181804-123181826 CCTACAAGCCAGAAGAGGGTGGG + Intergenic
1015861916 6:137690322-137690344 CCTAAAGAGCAGAAGGGAGTGGG + Intergenic
1016088326 6:139943586-139943608 CATCAGAATCAGAAGGGGGTGGG + Intergenic
1016187859 6:141220664-141220686 GCTCATAGGCAGAAGGGACTTGG - Intergenic
1016420596 6:143878474-143878496 TCTCAAAGGCGGAAGGGGAGGGG + Intronic
1017571003 6:155744304-155744326 CTTCAAAGGCAGAAGTGTGATGG - Intergenic
1018244485 6:161809247-161809269 CCTCAAAGGCAGGGGGGGAAGGG + Intronic
1018431119 6:163723564-163723586 CGCAAAAGGCAGAATGGGGTTGG + Intergenic
1019098566 6:169608841-169608863 GCTCATAGGCAGAAGGGACTTGG - Intronic
1019843088 7:3468900-3468922 CTTCAGAGGGTGAAGGGGGTAGG + Intronic
1020035850 7:4962753-4962775 CCTCATCGGCAGGAGGGGATAGG - Intergenic
1020788167 7:12594153-12594175 ACTCAGAGTCAGAAGTGGGTTGG + Intronic
1020995022 7:15252454-15252476 CCTCAAAGCCAGAAAGGGAAAGG - Intronic
1021556934 7:21929119-21929141 CCTACAAGCCAGAAGAGGGTGGG + Intronic
1021636992 7:22703644-22703666 CAGCAAAGGGAGATGGGGGTGGG - Intergenic
1021637857 7:22709190-22709212 CAGCAAAGGGAGATGGGGGTGGG - Intergenic
1022023512 7:26424098-26424120 CATCAAAGGCAGGAGTGGCTGGG - Intergenic
1022109050 7:27216758-27216780 TCTCCAAGGCAGCAGGGGTTTGG + Intergenic
1023344428 7:39256750-39256772 CTTCAAAGGCAGCAGCGGCTGGG - Intronic
1023509224 7:40933261-40933283 CCTACAAGCCAGAAGAGGGTGGG - Intergenic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1025262388 7:57427419-57427441 CCTCAAAGGCAGATGTGGGGAGG - Intergenic
1025739745 7:64184658-64184680 CCTCAAAGGCAGACATGGGGAGG - Intronic
1027481383 7:78701852-78701874 CCTCAAAGGTTGCAGGGGATTGG - Intronic
1027556574 7:79670940-79670962 GCTCACAGGCAGAAGGGACTTGG + Intergenic
1029202736 7:98849816-98849838 CATCAAAGGTAGAAGTAGGTTGG + Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030243686 7:107359061-107359083 CCTCCAACTCAGAAGTGGGTGGG - Intronic
1030245353 7:107379084-107379106 CCTAAAAGCCAGAAGAGAGTGGG + Intronic
1031119280 7:117703079-117703101 TCTGCAAGGCAGAAGGGGTTCGG + Intronic
1032043495 7:128582252-128582274 TCTCAAAGGCAGATGGATGTGGG - Intergenic
1032684902 7:134223417-134223439 TCTCAGAGGCAGCAGGGGGTAGG + Intronic
1033195143 7:139321311-139321333 CTTCCCAGGCAGGAGGGGGTGGG + Intergenic
1033322139 7:140349525-140349547 CATCAAAGGAAAAAGGGGGGGGG + Intronic
1033666539 7:143446039-143446061 TCTCAAAGGAAGAAGAGGGCTGG - Intergenic
1037465776 8:19158765-19158787 CCTTAAAGGAAGAAGTGGGCCGG + Intergenic
1037564484 8:20105941-20105963 GCACAGAGGGAGAAGGGGGTGGG + Intergenic
1037769141 8:21788930-21788952 CCGCGAAGGGAGAAGGGGGCGGG - Intronic
1037982103 8:23261657-23261679 CCTCAAAGGAGGCAGGGAGTGGG - Exonic
1038267338 8:26047139-26047161 GTCCAAAGGAAGAAGGGGGTAGG + Intergenic
1038281341 8:26168045-26168067 CCTCAGAAGGAGAAGGAGGTGGG - Intergenic
1039366818 8:36936833-36936855 CAACAAAGGTAGAAGGGGGGTGG + Intergenic
1039468467 8:37799507-37799529 TATCAAAGGCAGAAGGAAGTGGG + Intronic
1042401505 8:68353953-68353975 CCTCAGATGCAGAAGGGGATTGG - Intronic
1042843423 8:73147417-73147439 CCTGTCAGGCAGGAGGGGGTAGG - Intergenic
1042946379 8:74158320-74158342 CCTCTCAGCCAGAAGAGGGTGGG + Intergenic
1043237178 8:77882366-77882388 CCTGAAAGACAGAAGAGAGTAGG - Intergenic
1043568141 8:81570942-81570964 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
1043666759 8:82825169-82825191 CCTGAGAGTCAGTAGGGGGTGGG - Intergenic
1043838250 8:85069030-85069052 CAGCAAAGGGAGATGGGGGTGGG - Intergenic
1044120870 8:88393316-88393338 CCTCAAAGGTAAAAGAGGCTTGG + Intergenic
1044845019 8:96372012-96372034 CCTCAAAGGCAGACAGGGCTGGG - Intergenic
1048443400 8:134476392-134476414 CCTCAAGGGCATAAGGTAGTGGG - Intergenic
1048627967 8:136207224-136207246 TCTAAAAGTGAGAAGGGGGTGGG - Intergenic
1050382391 9:5042973-5042995 CCTCAGAAGCTGAGGGGGGTGGG + Intronic
1051911244 9:22155144-22155166 CCTCAAAGGCAGACGTGGGGAGG - Intergenic
1055341358 9:75287496-75287518 CCTACAAGCCAGAAGGGGGAGGG - Intergenic
1055614426 9:78056033-78056055 CCTACAAGCCAGAAGGGAGTGGG + Intergenic
1056459968 9:86800142-86800164 ACTCAAATGCAGAAAGGGTTGGG + Intergenic
1056522065 9:87411023-87411045 CAGCAAAGGCAGATAGGGGTGGG - Intergenic
1056756490 9:89385174-89385196 CCTCAAAGGCAGAAGGGGGTAGG - Intronic
1056868618 9:90255056-90255078 CCTAAAAGACAGAATGGGATGGG - Intergenic
1056986083 9:91364561-91364583 ACTCCTGGGCAGAAGGGGGTGGG + Intergenic
1056996976 9:91472032-91472054 CCTCCAAGTCAGAAGAGAGTGGG - Intergenic
1057051634 9:91928310-91928332 CCTCAAGGGCAGCAGCAGGTTGG - Intronic
1057551522 9:96054106-96054128 CTTCCAGGGCAGAAGGGGGCTGG + Intergenic
1058079269 9:100685276-100685298 CCTCAAGGAGAGAAGGAGGTTGG + Intergenic
1059104669 9:111501301-111501323 CCACCAACTCAGAAGGGGGTGGG - Intergenic
1059284845 9:113163355-113163377 CCTCAAAGACAGAAGAGGTCAGG - Exonic
1060906875 9:127314573-127314595 CCTCCAAGGCAGGAGAGGGTGGG + Intronic
1061243159 9:129386131-129386153 AGTCAAAGGCAGATGGGGCTAGG + Intergenic
1061267336 9:129514424-129514446 CTTCCTGGGCAGAAGGGGGTGGG + Intergenic
1062000076 9:134211475-134211497 CCTCCAAGGCTGCAGGGGGTGGG + Intergenic
1062197586 9:135282823-135282845 CCTCCTTGGCAGAAGGAGGTTGG + Intergenic
1062229224 9:135472175-135472197 CCTGAAAGGCAAAAGGAGGTTGG - Intergenic
1062319575 9:135984191-135984213 CCTAAAGGGCAGGAGGGGCTGGG + Intergenic
1062545713 9:137063011-137063033 CCTCAAAGGCAGACGTGGGGAGG + Exonic
1186223819 X:7376221-7376243 CCTCTAACTCAGAAGGGGGTGGG + Intergenic
1189068917 X:37843925-37843947 TTTCAATGGCAGAAGAGGGTTGG + Intronic
1189935835 X:46067316-46067338 CAGCAAAGGGAGATGGGGGTAGG - Intergenic
1189978281 X:46484695-46484717 CCTATAAGCCAGAAGAGGGTGGG - Intronic
1190506076 X:51127035-51127057 CCTACAAGGCAGAAGAGAGTAGG + Intergenic
1191005274 X:55704249-55704271 CCTACAAGCCAGAAGAGGGTGGG + Intergenic
1191222541 X:58004558-58004580 CCTAAAAGCCAGAAGAGAGTGGG + Intergenic
1192000803 X:67149392-67149414 CCTACAAGGCAGAAGAGAGTGGG - Intergenic
1192018637 X:67359563-67359585 CCTACAAGACAGAAGAGGGTGGG + Intergenic
1192692877 X:73382659-73382681 CCTACAAGCCAGAAGGGAGTGGG + Intergenic
1192883443 X:75312456-75312478 CCTACAAGGCAGAAGAGGGTAGG - Intergenic
1192977476 X:76301742-76301764 CCTACAAGCCAGAAGAGGGTGGG - Intergenic
1193251291 X:79293478-79293500 CCTTAAAGTCAGAAGGGCTTAGG + Intergenic
1193409516 X:81145317-81145339 CCTAAAAGCCAGAAGAGAGTGGG + Intronic
1193605733 X:83566045-83566067 CCTACAAGCCAGAAGAGGGTGGG - Intergenic
1194098765 X:89675931-89675953 CCTACAAGGCAGAAGAGAGTGGG + Intergenic
1194316020 X:92379108-92379130 CCTCCAATTCAGAAGGAGGTGGG - Intronic
1194771991 X:97917061-97917083 CCTACAAGCCAGAAGGGAGTAGG + Intergenic
1194909995 X:99630418-99630440 GCTCATAGGCAGAAGGGACTTGG - Intergenic
1195832686 X:109077118-109077140 CCTAAAAGCCAGAAGAGAGTGGG - Intergenic
1196631286 X:117943154-117943176 CCTACAAGGCAGAAGAGAGTGGG - Intronic
1196930174 X:120674268-120674290 CCTCATAGGCAGAGGGGATTAGG - Intergenic
1197624883 X:128790761-128790783 CCTAAAAGCCAGAAGAGAGTGGG + Intergenic
1198595643 X:138232528-138232550 CCTACAAGCCAGAAGGGAGTGGG + Intergenic
1199524720 X:148780075-148780097 CCTAAAAGCCAGAAGAGAGTGGG - Intronic
1200371228 X:155727131-155727153 CCTACAAGCCAGAAGGGAGTAGG - Intergenic
1200451790 Y:3337304-3337326 CCTACAAGGCAGAAGAGAGTGGG + Intergenic
1201397342 Y:13563602-13563624 CCTCCAAGCCAGAAGAGAGTGGG - Intergenic