ID: 1056756599

View in Genome Browser
Species Human (GRCh38)
Location 9:89385720-89385742
Sequence AAGAGGGCCCCTGTCTGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 216}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056756599_1056756612 21 Left 1056756599 9:89385720-89385742 CCCGGCCAGACAGGGGCCCTCTT 0: 1
1: 0
2: 2
3: 27
4: 216
Right 1056756612 9:89385764-89385786 TGAGGGAGGAGAGGACTGACTGG No data
1056756599_1056756608 7 Left 1056756599 9:89385720-89385742 CCCGGCCAGACAGGGGCCCTCTT 0: 1
1: 0
2: 2
3: 27
4: 216
Right 1056756608 9:89385750-89385772 CTGTTGCTCCCAGCTGAGGGAGG No data
1056756599_1056756614 27 Left 1056756599 9:89385720-89385742 CCCGGCCAGACAGGGGCCCTCTT 0: 1
1: 0
2: 2
3: 27
4: 216
Right 1056756614 9:89385770-89385792 AGGAGAGGACTGACTGGGCCTGG No data
1056756599_1056756613 22 Left 1056756599 9:89385720-89385742 CCCGGCCAGACAGGGGCCCTCTT 0: 1
1: 0
2: 2
3: 27
4: 216
Right 1056756613 9:89385765-89385787 GAGGGAGGAGAGGACTGACTGGG No data
1056756599_1056756609 12 Left 1056756599 9:89385720-89385742 CCCGGCCAGACAGGGGCCCTCTT 0: 1
1: 0
2: 2
3: 27
4: 216
Right 1056756609 9:89385755-89385777 GCTCCCAGCTGAGGGAGGAGAGG No data
1056756599_1056756605 3 Left 1056756599 9:89385720-89385742 CCCGGCCAGACAGGGGCCCTCTT 0: 1
1: 0
2: 2
3: 27
4: 216
Right 1056756605 9:89385746-89385768 CTGCCTGTTGCTCCCAGCTGAGG No data
1056756599_1056756606 4 Left 1056756599 9:89385720-89385742 CCCGGCCAGACAGGGGCCCTCTT 0: 1
1: 0
2: 2
3: 27
4: 216
Right 1056756606 9:89385747-89385769 TGCCTGTTGCTCCCAGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056756599 Original CRISPR AAGAGGGCCCCTGTCTGGCC GGG (reversed) Intronic
900244764 1:1631888-1631910 AAGAGGGCCCCAGGCAGCCCGGG - Intergenic
901439102 1:9266808-9266830 AAGAGATGCTCTGTCTGGCCTGG - Exonic
902318862 1:15645575-15645597 GAGTGGGCCACTGGCTGGCCGGG + Intronic
903347756 1:22698186-22698208 ATGAGGGCCCCTGACCAGCCAGG + Intergenic
904037952 1:27568769-27568791 AAGAGCGCCCCGGCCCGGCCCGG - Intronic
904598956 1:31663410-31663432 AAGTGGGCACATGCCTGGCCTGG + Intronic
907373592 1:54018284-54018306 AGGAGGGCCCCTCTCCGGCCAGG + Intergenic
915857573 1:159405940-159405962 AAGAGGGCTTGTGTCTGGCTGGG - Intergenic
916218299 1:162417825-162417847 AAGATGGCCCCTGTTTTGTCTGG + Intergenic
918282723 1:183022861-183022883 AAGAGGGTCCCCGCCCGGCCAGG - Intergenic
920183478 1:204146830-204146852 TGGAGGGTCCCTATCTGGCCAGG - Intronic
922555586 1:226529865-226529887 GAGTCGGCCCCTGACTGGCCTGG + Intergenic
1063666159 10:8061924-8061946 AGGGGGTCCCCTGTCTGGGCAGG + Intronic
1064119321 10:12605512-12605534 GAGTGGGCCCCTGAGTGGCCTGG - Intronic
1068821023 10:61377298-61377320 TGGAGGGCCCCTCTCTGGGCTGG - Intergenic
1069579335 10:69554695-69554717 ATGAGGGACCTTGTCAGGCCAGG + Intergenic
1069834666 10:71301081-71301103 AAGCGGGCACCTGCCTTGCCTGG - Exonic
1069896315 10:71682373-71682395 AAGGGGACCCCTGTCTGGACGGG + Intronic
1070757994 10:79005413-79005435 GCCAGGGCTCCTGTCTGGCCGGG - Intergenic
1075391604 10:122096399-122096421 AAGAGTGCCCCTTACCGGCCAGG + Intronic
1075879572 10:125839247-125839269 AAGATGGCAACTGCCTGGCCTGG - Intronic
1076736349 10:132460896-132460918 AGGAGGGCCCCTCACTGGCCTGG - Intergenic
1076898798 10:133327019-133327041 AAGACCGCCCCTGCCTGGCGTGG - Intronic
1076898962 10:133327800-133327822 AAGGGGACCCCAGACTGGCCTGG + Intronic
1076939236 10:133590638-133590660 ATGTGGGCCCTGGTCTGGCCTGG + Intergenic
1077233743 11:1470144-1470166 ACGTGTGCCCCTGTCCGGCCCGG + Exonic
1077358717 11:2130311-2130333 GAGAAGGCCACTGTCCGGCCTGG - Intronic
1077416476 11:2426464-2426486 ACGATGGCCCCTGGCTGTCCCGG - Intergenic
1079101793 11:17546630-17546652 ACGAGGTCCACTGTCTGCCCAGG - Intergenic
1079142801 11:17824004-17824026 AAAAGGGCCTCTTTTTGGCCGGG + Intronic
1083682393 11:64357624-64357646 CAGAGGGCCCCTGCCTGGACAGG + Intergenic
1083726665 11:64632004-64632026 AAGACTGCCCCAGTCTGGCCTGG + Intronic
1085323527 11:75589331-75589353 CAGAGGGCTCCAGGCTGGCCGGG - Intronic
1085755313 11:79197034-79197056 AAAAGGGCCCCAGTCTGGCATGG - Intronic
1089786265 11:120909467-120909489 AAGATGGCCAATGTCTGGGCAGG - Intronic
1091590132 12:1837813-1837835 AACGGGGCCCCTCTCAGGCCTGG + Intronic
1094658170 12:32441043-32441065 AAGTGGGCTCCCCTCTGGCCTGG + Intronic
1096479162 12:51926483-51926505 AAGAGGGACCCAGCTTGGCCTGG + Intergenic
1096843987 12:54395456-54395478 GGGAGGGCCTGTGTCTGGCCAGG + Exonic
1096844387 12:54397606-54397628 GGGAGGGCCTGTGTCTGGCCAGG + Intronic
1098893097 12:76030295-76030317 GCGAGGCCCCCTGCCTGGCCCGG + Intronic
1101432247 12:104636265-104636287 GAGAGGAACCCAGTCTGGCCAGG - Intronic
1103606083 12:122087111-122087133 GAGAGGGAGCCTGGCTGGCCGGG + Intronic
1103877962 12:124143480-124143502 AAGAGGACCACTGTCTCCCCAGG + Intronic
1104962275 12:132493887-132493909 AGGAGGGCCAGGGTCTGGCCTGG + Intronic
1105242715 13:18621991-18622013 AAGAGGGCCCCTCTGTGACCTGG - Intergenic
1105419477 13:20239746-20239768 ACGCTGGCCCCTCTCTGGCCTGG - Intergenic
1106504067 13:30356049-30356071 AAGAGGGCCACTGGCAGCCCTGG - Intergenic
1113008045 13:105730143-105730165 AAGAGGGACCCTGGCTGTCCAGG + Intergenic
1117837302 14:59819971-59819993 GTGAGAGCCCCTGTCTGGGCTGG - Intronic
1118440131 14:65804551-65804573 AAGGGGGCCCCTGTGTGGTCCGG + Intergenic
1119755716 14:77117791-77117813 AAAGGGGCTCCTGACTGGCCTGG - Intronic
1121794286 14:96722731-96722753 ACGAGGGGCCCTGTCTGCCTGGG + Intergenic
1122134299 14:99624061-99624083 AGTAGCTCCCCTGTCTGGCCTGG - Intergenic
1122325769 14:100879981-100880003 AAGAGGGCCCCTGCATGCCTTGG - Intergenic
1122543971 14:102512258-102512280 CAGAGGCCACCTGACTGGCCAGG + Intergenic
1122595464 14:102887349-102887371 AAGAGGGCCCATGTGGGGCTAGG + Intronic
1122823481 14:104358708-104358730 AAGTGAGCCCCTGCCCGGCCTGG - Intergenic
1123488584 15:20762614-20762636 AAGAGGGCCCCTCTGCGGCCTGG + Intergenic
1123545080 15:21331687-21331709 AAGAGGGCCCCTCTGTGGCCTGG + Intergenic
1124710322 15:32004921-32004943 AAGTCAGCCTCTGTCTGGCCAGG + Intergenic
1128558113 15:68645395-68645417 AGGAGGGCTCCTCTCTGCCCTGG - Intronic
1128934187 15:71731494-71731516 ATGAGCCCCCTTGTCTGGCCTGG - Intronic
1202953426 15_KI270727v1_random:58958-58980 AAGAGGGCCCCTCTGTGGCCTGG + Intergenic
1132854073 16:2037046-2037068 AAGGGGGCCTCTGTCGGGCCTGG - Intronic
1133201443 16:4206833-4206855 CAGAGGGGCCCAGCCTGGCCCGG - Intronic
1133246816 16:4454710-4454732 ACGTGGGCCCCTGGGTGGCCAGG + Intronic
1136016805 16:27405853-27405875 AGGAGGGCCCCCGACTGCCCAGG + Intronic
1136454411 16:30372174-30372196 AAGTGGGCTCCTCCCTGGCCTGG + Intronic
1137568745 16:49550934-49550956 TAGAGGGCCCCTTTGTGGCTGGG + Intronic
1137720360 16:50624123-50624145 AAGGTGGCACCTGGCTGGCCTGG - Intronic
1138197309 16:55061193-55061215 AGCATAGCCCCTGTCTGGCCAGG + Intergenic
1138439610 16:57026216-57026238 AGGAGGGCCACAGACTGGCCTGG - Exonic
1138494550 16:57399741-57399763 AAGAAGGTCCATGTCAGGCCAGG - Intergenic
1138880928 16:61014437-61014459 CAGAGGACCCCTGTGAGGCCAGG - Intergenic
1139620797 16:68140278-68140300 AAGAAGTCCCCTTTCTGGCCAGG - Intronic
1140124603 16:72108954-72108976 TGCAGGCCCCCTGTCTGGCCAGG + Intronic
1140297676 16:73725304-73725326 AACAGGGCCCTTTTGTGGCCAGG - Intergenic
1140481037 16:75263045-75263067 CAGAGGGCCTGTGTCTTGCCAGG - Intronic
1141548259 16:84786827-84786849 CAGAGGGCCCCTGCCATGCCTGG + Intergenic
1142333970 16:89474925-89474947 AAGCTGGGCCCTGCCTGGCCGGG + Intronic
1143104364 17:4521183-4521205 AAGTTTCCCCCTGTCTGGCCAGG - Intronic
1143874584 17:9982012-9982034 AAGCAGGGTCCTGTCTGGCCAGG - Intronic
1143899124 17:10160186-10160208 ATGAGCGACCCTGTCTGGCCAGG + Intronic
1144997705 17:19281884-19281906 AAGAAGGCCACAGTCTGGCAGGG - Intronic
1147327350 17:39675842-39675864 CCTAGTGCCCCTGTCTGGCCTGG + Intronic
1147978305 17:44260284-44260306 AAGTGGGCCCCTGCCTGGTGAGG + Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150486509 17:65547372-65547394 TACAGGGCCTGTGTCTGGCCTGG + Intronic
1150743747 17:67799984-67800006 AAGAAGTCCCCAGCCTGGCCGGG - Intergenic
1151643338 17:75412833-75412855 AAGAGGCTCACTGTCAGGCCGGG - Intergenic
1152292920 17:79450742-79450764 AGGAGGACCCCTGTCTGGCAAGG + Intronic
1152610752 17:81314086-81314108 CAGAGCGCCCCTGCCCGGCCTGG + Intronic
1152722065 17:81928095-81928117 AAGAGCGCCTCTGCCTGGCAGGG - Intergenic
1152753639 17:82077910-82077932 AATAGCGCCACTGGCTGGCCAGG - Intergenic
1154446225 18:14437886-14437908 AAGAGGGCCCCTCCATGGCCTGG + Intergenic
1156160661 18:34354400-34354422 CAGATGTCTCCTGTCTGGCCTGG + Intergenic
1156610543 18:38718809-38718831 ATGGGAGCCCCTTTCTGGCCTGG - Intergenic
1157444858 18:47737028-47737050 AAAATGGCACATGTCTGGCCAGG + Intergenic
1157580619 18:48771889-48771911 TAGAGGCGCCCTGTCTGGGCCGG - Intronic
1157582619 18:48782308-48782330 TCCAGGGCCCCTGCCTGGCCTGG + Intronic
1159063839 18:63546205-63546227 ACGAGGACCCCTCTCTGACCTGG - Intergenic
1160554384 18:79716564-79716586 AGGAGGACCCCGGCCTGGCCCGG - Intronic
1160583902 18:79902319-79902341 TAGAAGGCCCCTGTGTGACCTGG - Intergenic
1160754954 19:752225-752247 AAGATGGCCCCTGCAAGGCCCGG - Intronic
1161060838 19:2214022-2214044 CAGAGGGGCCCTGCCTGGGCGGG + Intronic
1161208776 19:3055835-3055857 AAGAGGGGCTAGGTCTGGCCAGG + Intronic
1161263065 19:3348221-3348243 AAGGGCTCCCCTGCCTGGCCTGG + Intergenic
1161715926 19:5876409-5876431 AAGAGAGCCCCTATCTGGGGAGG - Intronic
1162540358 19:11292001-11292023 CAGAAGACCCCTGTCAGGCCAGG - Intergenic
1163273134 19:16266293-16266315 AAGTGAGCCCCTGTCAGGCCTGG - Intergenic
1165061721 19:33208072-33208094 CAAAGGGCGCCTGCCTGGCCAGG - Exonic
1165981250 19:39726287-39726309 AGGAAGGCTCCTGTTTGGCCTGG - Intergenic
1166014681 19:39971173-39971195 AAGCCGGCCTCTGTGTGGCCTGG - Exonic
1166722387 19:45004211-45004233 AAAAGAACCACTGTCTGGCCAGG - Intronic
1166997983 19:46728795-46728817 AAGAGGCCCCCTGACTTGTCTGG - Intronic
1167277412 19:48546681-48546703 CAGAGGCCCCCTCTTTGGCCTGG + Intergenic
1167635399 19:50651540-50651562 CAGAGGGCCCCTGTGTGCCTTGG - Intronic
1168108484 19:54179042-54179064 CAGAGGGCCATTGCCTGGCCAGG - Intronic
1168309927 19:55455235-55455257 GAGAGGGCCCCTGCCTGGGTGGG - Intronic
925308396 2:2865663-2865685 GTGAGGGCCCCTGTCTGGGGCGG + Intergenic
925308569 2:2866131-2866153 GTGAGGGCCCCTGTCTGGGGCGG + Intergenic
925308605 2:2866234-2866256 GTGAGGGCCCCTGTCTGGGGTGG + Intergenic
926300296 2:11597138-11597160 GCGAGGGCCTCGGTCTGGCCTGG + Intronic
927573704 2:24182685-24182707 GAGAGGGCCCCTCTCAGGACTGG + Intronic
930046675 2:47178426-47178448 AAGAGGACCCACCTCTGGCCTGG - Intergenic
930241841 2:48943501-48943523 AAGGGAGCCACTGTCTGGGCAGG - Intergenic
931441566 2:62293951-62293973 AACAGGGCGCCTGGCTGGTCTGG + Intergenic
931654752 2:64500821-64500843 CACAGGGCCTCTGTTTGGCCTGG - Intergenic
932423194 2:71613292-71613314 GAGAGAGCCCCTCTCAGGCCTGG + Intronic
933491109 2:82986146-82986168 AGGGGGGCCCCTCTCTGGGCTGG - Intergenic
934575791 2:95400499-95400521 TAGAGGGTCTGTGTCTGGCCTGG + Intergenic
935048341 2:99502153-99502175 AAAAGTACCTCTGTCTGGCCAGG + Intergenic
935696675 2:105776551-105776573 TAGAGGTCCCCTGCCAGGCCAGG - Intronic
941462905 2:165793373-165793395 AAGTGGGCCCAACTCTGGCCTGG + Intronic
941631705 2:167891558-167891580 AGAAGGACCCCTGTGTGGCCAGG + Intergenic
941771921 2:169353962-169353984 AAGTGAGACCCTCTCTGGCCTGG + Intronic
942078722 2:172380826-172380848 AAAAGAGGCCCTGCCTGGCCAGG - Intergenic
948764229 2:240211356-240211378 ACGAGGGCACCTCTGTGGCCTGG - Intergenic
948985503 2:241520230-241520252 AAGAAGGCCCCTGCCGGGCATGG + Intergenic
1171488183 20:25498581-25498603 AAGAGGGGTTCTGTCTAGCCTGG - Intronic
1172046919 20:32086897-32086919 GAGATGGCCCCAATCTGGCCAGG + Intronic
1172770911 20:37382078-37382100 AAAAGGCCCCCTGACTGGCTGGG - Intronic
1172894758 20:38292624-38292646 AAGAGGAACCCTGGCTGGGCTGG - Intronic
1172981357 20:38944642-38944664 AAGAAGGCCTATTTCTGGCCGGG + Intronic
1173022502 20:39278767-39278789 AAGAGAGACTCTGTGTGGCCAGG + Intergenic
1174387267 20:50194533-50194555 AAGAGGGGCACCGTCTGGCCAGG - Intergenic
1174552604 20:51372739-51372761 GAGATGGCCTCTGTGTGGCCCGG - Intergenic
1175105245 20:56610378-56610400 AAGTGGTCCCCTCTCGGGCCAGG - Intergenic
1176449757 21:6851960-6851982 AAGAGGGCCCCTCCATGGCCTGG - Intergenic
1176695154 21:9968422-9968444 AGGAGGGCCCCAGTATTGCCAGG + Intergenic
1176827929 21:13716984-13717006 AAGAGGGCCCCTCCATGGCCTGG - Intergenic
1177255827 21:18661872-18661894 AAGAGTGCCCCTTGCTGACCAGG - Intergenic
1178332586 21:31712155-31712177 TAGAGGGCCCATGTCTTACCTGG - Intronic
1181572247 22:23773892-23773914 CAGAGGGTCCCAGCCTGGCCAGG - Intronic
1181726353 22:24813767-24813789 AGGAGGGCCCCTGGCTTGCCTGG + Intronic
1181955812 22:26587212-26587234 AAGGGGGCTCCAGGCTGGCCCGG + Intronic
1182928556 22:34151161-34151183 AAGATGGCTCCTTTCTGGCCAGG + Intergenic
1184457311 22:44618527-44618549 CAGAGCGCCCGTGGCTGGCCTGG + Intergenic
1184508762 22:44919612-44919634 AAGATGGCCCCTGCCTGTCGTGG - Intronic
952710946 3:36431488-36431510 GAGAGAGCCCCTGCCTGCCCAGG - Intronic
953885014 3:46710167-46710189 AGGAGGGACTCTGTCTGGCCAGG + Exonic
954222001 3:49160631-49160653 AGAATTGCCCCTGTCTGGCCGGG - Intergenic
954386366 3:50246146-50246168 CAGAGGGCCTTTGTCTGGCGGGG + Intronic
963037827 3:141047856-141047878 CAGGGGGCCCCAGTGTGGCCTGG + Intergenic
965118345 3:164520249-164520271 AAGCGTGTCCCTTTCTGGCCTGG + Intergenic
967632973 3:191768509-191768531 CAGTGGGCTTCTGTCTGGCCAGG - Intergenic
968414773 4:421580-421602 AAGCAAGACCCTGTCTGGCCTGG - Intergenic
968498636 4:932889-932911 GAGAGGGCCAGGGTCTGGCCTGG + Intronic
968621153 4:1604048-1604070 ATGATGGCCCCAGTGTGGCCTGG - Intergenic
968725720 4:2247017-2247039 CAGAGGGCTCCTGGCTGGCACGG + Intergenic
969610015 4:8222324-8222346 AAGGGGTGCCTTGTCTGGCCAGG - Intronic
971299524 4:25430279-25430301 AATACAGCCCCTGTCTGCCCTGG - Intergenic
975823215 4:78292694-78292716 AGGGGGGCCCCTGTCTTGCGAGG - Intronic
982758282 4:159250856-159250878 ATGGGGGCCCCTCTCTGGGCTGG + Intronic
984281740 4:177678736-177678758 AGGAAGGGCCCTGTCTGACCAGG - Intergenic
986244345 5:5991918-5991940 AAGCGGGCACCTGTGTGGCATGG + Intergenic
987384961 5:17320335-17320357 AATATGCCCCCTGTCTGGCCTGG + Intergenic
987957827 5:24763418-24763440 AAGAGGGGCCCTGTCTTCTCTGG - Intergenic
990724628 5:58740136-58740158 CACATGGCCCCTGCCTGGCCTGG - Intronic
992013941 5:72557238-72557260 GACAGGGCCCCTCTCTGGCTGGG - Intergenic
992510333 5:77426557-77426579 AAGAGGCCCCCTCTGTGGCTTGG - Exonic
997586253 5:135045331-135045353 AAGTGGGCCCCTCACTGGGCTGG - Intronic
999323175 5:150627074-150627096 TCCAGGGCCCCTGCCTGGCCTGG + Intronic
1002428787 5:179191331-179191353 AAGAGGGGCCCTAAGTGGCCAGG + Intronic
1002640880 5:180630149-180630171 AGGCGGCCGCCTGTCTGGCCAGG - Intronic
1003955889 6:11164794-11164816 AAGGGGGCTCCTGAGTGGCCGGG + Intergenic
1005973759 6:30781411-30781433 AAGAATGCCCATGTCTGGTCGGG - Intergenic
1006398974 6:33804994-33805016 AGGAGGTCCCCTGTGTGGGCTGG + Intergenic
1006520786 6:34569976-34569998 AAGTTGGCCCCTGTATGGGCAGG - Intergenic
1006964938 6:37973725-37973747 AAGAAGGCCTGTGTATGGCCTGG + Intronic
1007274422 6:40662903-40662925 AAGAGGGCTCCTGTCAGACTGGG + Intergenic
1007655946 6:43451011-43451033 CAGCGGGCCCCTCTCTGGCATGG + Exonic
1010673870 6:78719185-78719207 TACAGGGCCCCTCACTGGCCAGG - Intergenic
1011194152 6:84764746-84764768 AAAAGCGCCGCTGTCTGGCTTGG + Intergenic
1015440288 6:133240755-133240777 AAAAGCGCCCCAGTCTGGTCTGG + Intronic
1017027862 6:150197407-150197429 CAGAGGGCACCTGTCTTGCATGG + Intronic
1019151344 6:170007975-170007997 AAGAGGCACCCTGTCCAGCCTGG - Intergenic
1019294210 7:265460-265482 AAGAGGGCGGCTGTCCGGGCGGG - Intergenic
1019355605 7:577274-577296 AGGAGGGCACCTCTCTGCCCTGG - Intronic
1019481437 7:1268674-1268696 AAGAGGGCCACTGGGTGTCCTGG - Intergenic
1023052723 7:36267316-36267338 ATGGGGGCCCCTGCATGGCCAGG + Intronic
1023809749 7:43902471-43902493 AATATGGTCCCTTTCTGGCCAGG - Intronic
1023881590 7:44324424-44324446 CAGGGGCCTCCTGTCTGGCCTGG - Intronic
1024460656 7:49656106-49656128 AAGAGGGCTCCAGTCTGGAGGGG + Intergenic
1026251122 7:68671703-68671725 AAGAGCGCCCCTATCTGGACTGG + Intergenic
1026420904 7:70235932-70235954 AAGAGGGCCCCTGTGAAGACAGG - Intronic
1026468745 7:70676579-70676601 AAATGGGCACCTTTCTGGCCGGG + Intronic
1026772873 7:73213261-73213283 ATGAGGGCCCATGTCGTGCCTGG + Intergenic
1027013736 7:74766657-74766679 ATGAGGGCCCATGTCGTGCCTGG + Intergenic
1027074302 7:75179375-75179397 ATGAGGGCCCATGTCGTGCCTGG - Intergenic
1027509198 7:79057936-79057958 AATAGAGCCCCTTTCTGGGCAGG - Intronic
1034567197 7:151924628-151924650 GAGAGGGCAGCTGGCTGGCCTGG - Intergenic
1034670250 7:152852294-152852316 AGGAGGGCCCCGGTCAGGCCTGG - Intronic
1040452649 8:47563467-47563489 AAGAGGGCCCATGTGGGGCCAGG - Intronic
1040745404 8:50635691-50635713 AAGTGGGCTCCCCTCTGGCCTGG + Intronic
1043076558 8:75708458-75708480 AAGAGGGGCCCTTTATGGCATGG + Intergenic
1048787307 8:138063765-138063787 AAGAGGGGCTGTGTCTGGCGGGG + Intergenic
1049331619 8:142057029-142057051 AAGAGGGCCCCTCCCTAGGCTGG - Intergenic
1049529671 8:143148090-143148112 AGGAGGGCCACTGTCAGGCGAGG + Intergenic
1049732120 8:144183940-144183962 AAGAAAGGCCTTGTCTGGCCAGG - Intronic
1049755857 8:144311051-144311073 AAGTGTGACCATGTCTGGCCTGG - Intronic
1049765559 8:144353749-144353771 AGGAGGGCGCGTGTCTGGGCGGG + Intronic
1050093459 9:2039558-2039580 ATGAGGGCCCCCGGCTGGCTTGG - Exonic
1053472324 9:38355697-38355719 CAGAAGGCCCCTCTCTGGCTTGG - Intergenic
1053632131 9:39954368-39954390 AGGAGGGCCCCAGTATTGCCAGG + Intergenic
1053773635 9:41509167-41509189 AGGAGGGCCCCAGTATTGCCAGG - Intergenic
1054211757 9:62296330-62296352 AGGAGGGCCCCAGTATTGCCAGG - Intergenic
1054567516 9:66774758-66774780 CAGAGGCTCCCTGGCTGGCCTGG + Intergenic
1055266571 9:74500117-74500139 AAGAGGGCGCCAGCCTCGCCAGG + Intronic
1055454013 9:76456399-76456421 GAGAGGGCCCCTGGTTGGCTGGG - Intronic
1056756599 9:89385720-89385742 AAGAGGGCCCCTGTCTGGCCGGG - Intronic
1061520311 9:131113855-131113877 ATGAGGGCCCCACTCTGCCCGGG + Intronic
1062070921 9:134554593-134554615 AAGGGGGGCCCTGTCAGTCCAGG - Intergenic
1062344909 9:136110104-136110126 GAAAGGGCCCCTCTCTGCCCAGG - Intergenic
1062448763 9:136606830-136606852 AAGAGGGCGGCTGGCTGGACGGG - Intergenic
1203519427 Un_GL000213v1:32557-32579 AAGAGGGCCCCTCCATGGCCTGG + Intergenic
1187326986 X:18300032-18300054 AAGAGTTCCCTTTTCTGGCCAGG - Intronic
1189719260 X:43898549-43898571 TTGAGGGCCTCTGTCTGCCCAGG - Intergenic
1197091877 X:122548699-122548721 GAGAGATCCGCTGTCTGGCCAGG - Intergenic
1198429183 X:136548735-136548757 AGGAGGGCCTCTGTTCGGCCTGG + Exonic
1200070437 X:153526389-153526411 CAGAGGCCCCCTCTCAGGCCGGG - Intronic
1200090556 X:153633947-153633969 TGGAGGGCCCCTCTCAGGCCAGG + Intergenic
1200252806 X:154562710-154562732 AAGAGTGGCCCTGGCTGACCAGG - Intronic
1200264961 X:154641706-154641728 AAGAGTGGCCCTGGCTGACCAGG + Intergenic
1200873685 Y:8128943-8128965 GTGAGGGCCCCTCTCTGGGCTGG - Intergenic