ID: 1056757515

View in Genome Browser
Species Human (GRCh38)
Location 9:89391207-89391229
Sequence TGCCATGGCAATAGTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056757515_1056757521 4 Left 1056757515 9:89391207-89391229 CCAGGCACACTATTGCCATGGCA 0: 1
1: 1
2: 0
3: 10
4: 102
Right 1056757521 9:89391234-89391256 CCAAGCGAAGCCAGAGTGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056757515 Original CRISPR TGCCATGGCAATAGTGTGCC TGG (reversed) Intronic
900895053 1:5477621-5477643 TGGCTTTGCCATAGTGTGCCAGG - Intergenic
902821780 1:18947843-18947865 CGCCATGGCAATATTGTGACAGG + Intronic
904417397 1:30371742-30371764 TGGCCTGGCCATCGTGTGCCAGG - Intergenic
904939348 1:34154298-34154320 CACCATGGAAATGGTGTGCCAGG - Intronic
905361873 1:37426361-37426383 TGTCATGGCAGTACTGTGCATGG + Intergenic
906107491 1:43303717-43303739 TGCAGTGGCAATATTGTGGCAGG - Intronic
909478257 1:76106857-76106879 TGTCATGGGAAAAGTGTGCATGG + Intronic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
918977377 1:191507176-191507198 TGCCATGCCATTAGTGAGCAGGG - Intergenic
920959765 1:210653972-210653994 TGTGATGGGAATAGTGTGACGGG + Intronic
922037779 1:221866238-221866260 TGCCATGGCAATACATTTCCAGG - Intergenic
1063123899 10:3123820-3123842 TGCCATGGCCAGAGCCTGCCAGG + Intronic
1069045685 10:63741023-63741045 TGTCATGGCAATAGTGAGTTCGG - Intergenic
1069669369 10:70188880-70188902 TGCCATGGGGATAGTGTGCAGGG - Intergenic
1080311993 11:30905451-30905473 TGCCATGGCCAGAGAGAGCCTGG + Intronic
1081551365 11:44115644-44115666 TCTCATGGAAATAGTTTGCCTGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1086272213 11:85081233-85081255 AGACATGGGAATAGTGTGTCCGG + Intronic
1087828993 11:102798673-102798695 TGCTATCGCAATAGGGTACCAGG - Intergenic
1094067730 12:26379108-26379130 TGCCATGCCCATAATGTGCCAGG - Intronic
1098613133 12:72486114-72486136 AGACATGTCAATACTGTGCCTGG + Intronic
1101693773 12:107105729-107105751 TGCCATGCCCCTAGTCTGCCAGG + Intergenic
1104365713 12:128174705-128174727 TGCCATGGCAACACCATGCCTGG + Intergenic
1105473374 13:20711477-20711499 TGCCATGGTAACAGTGTGGGAGG - Intronic
1108544640 13:51480521-51480543 TTTAATGGCAATCGTGTGCCAGG - Intergenic
1110361570 13:74631113-74631135 TGCCATGGCATTAGTGGGGAGGG + Intergenic
1111058996 13:82987763-82987785 TTTCATGGCAATGGTTTGCCTGG + Intergenic
1112318151 13:98383216-98383238 TGCCTTGACAATAGAGGGCCTGG - Intronic
1112655513 13:101448425-101448447 GGCTATGGCAATAGTGTACGAGG + Intergenic
1113469173 13:110532154-110532176 TGCCAGGGCAAGAGTGGGGCTGG + Intronic
1118059997 14:62125854-62125876 TGCCATATCAATAGAATGCCAGG - Intergenic
1121437968 14:93931398-93931420 TGCCCAGGGAATAATGTGCCTGG + Intergenic
1121981478 14:98458089-98458111 TGCCATTGAACTATTGTGCCTGG - Intergenic
1128909486 15:71499369-71499391 TGGCATGGCAAAAATGTGCTAGG - Intronic
1131172021 15:90185252-90185274 TGCCATGGCAACAGGCTCCCCGG - Intronic
1132504824 16:302547-302569 TGCCATCTCAATGGAGTGCCCGG + Intronic
1134296212 16:12948075-12948097 TGCCAAACCAATTGTGTGCCAGG + Intronic
1135417534 16:22280142-22280164 TACCATGGCAACAGGGTGGCAGG - Intronic
1136088852 16:27904000-27904022 CCCCAAGGCAAGAGTGTGCCTGG - Intronic
1139794781 16:69473667-69473689 TGACATGGCACAAGTGTGACAGG - Intergenic
1142511103 17:393978-394000 AGCCAGGGCAAGAGTGTTCCAGG + Intergenic
1143350634 17:6285625-6285647 TGCCATGCCAATTCTGGGCCTGG - Intergenic
1144785971 17:17831789-17831811 TGCCCTGGCTATAGTGTCCCTGG - Intronic
1149600448 17:57889886-57889908 GGCCATGGCTGTGGTGTGCCTGG + Intronic
1149979897 17:61302128-61302150 TGGCATGGCAAGAGTGGGACAGG - Intronic
1151655266 17:75492875-75492897 TGCCCTGGCAATACCCTGCCAGG - Intronic
1152425535 17:80216643-80216665 CGCCATGGCCACAGTGTCCCAGG - Intronic
1156796308 18:41050589-41050611 TGCCCTGACACTAGTGTCCCTGG - Intergenic
1157944535 18:51964269-51964291 TGCAAAGGCAGTAGTGAGCCAGG - Intergenic
1162810040 19:13158629-13158651 TGCCAAGGCAATGGGGTGACTGG - Intergenic
1163152366 19:15422918-15422940 CGCCCTGGCTGTAGTGTGCCCGG + Exonic
1166377398 19:42335251-42335273 TGCCCTGGCCATAGGCTGCCGGG - Intronic
925530077 2:4849706-4849728 TGTCAAGGGAATACTGTGCCAGG - Intergenic
926646268 2:15292868-15292890 TGAAATGGCAATAGTGTACAGGG - Intronic
926781221 2:16473918-16473940 AGCCATGGGAATAGTGTGTATGG + Intergenic
927314302 2:21664296-21664318 TGGCATGGCAAGAGTGAGCAAGG + Intergenic
929446779 2:42008423-42008445 TGCTATGGCAAGAAAGTGCCAGG + Intergenic
930637561 2:53822850-53822872 TGCTATGGCAATGGGGAGCCAGG - Intergenic
947542505 2:230988614-230988636 TTCCATGGCTTCAGTGTGCCAGG + Intergenic
1170637653 20:18122460-18122482 AGACATGGCAAAAGTGTGGCCGG - Intergenic
1173465516 20:43278157-43278179 TTCCAAGGCAATTTTGTGCCTGG - Intergenic
1179166396 21:38938525-38938547 TACCATGGCAACAGTGTCCCTGG - Intergenic
1181886275 22:26024673-26024695 CGCCATGGCAATGATGGGCCCGG - Intronic
1184301579 22:43563876-43563898 TGGCATGGCCACTGTGTGCCTGG - Intronic
1185280942 22:49969601-49969623 TGCCAAGGCTACAGTGTGCCAGG + Intergenic
949516908 3:4815591-4815613 TCCCGTGCCTATAGTGTGCCAGG - Intronic
951527716 3:23669825-23669847 TGCCATGGTAATACTGGGCATGG - Intergenic
952391237 3:32882434-32882456 TCACATGGCAAGAGTGTGACAGG - Intronic
953215016 3:40909852-40909874 TGCCACTGCCATAGTGGGCCAGG + Intergenic
956754734 3:72373498-72373520 TCCCATGGCTAGAGTGTGACAGG - Exonic
957382451 3:79449830-79449852 TGTGATGGCCATAGTGTGTCAGG + Intronic
957702859 3:83740607-83740629 TGCCATCCCAATACTGTGCTTGG + Intergenic
962212326 3:133489736-133489758 TGCCAGGTCAATAGTGGCCCAGG - Intergenic
962733120 3:138300909-138300931 TGCCTCGGCATCAGTGTGCCTGG + Intronic
963585292 3:147178965-147178987 TGCAATGTCAATACTGTACCTGG + Intergenic
967629049 3:191721382-191721404 TGCCATGGCACAAGTATTCCTGG - Intergenic
968581832 4:1398879-1398901 TGCCATGGCAATGGTGTGCCTGG - Intergenic
971095626 4:23399126-23399148 TAGCATGGCAATATTGTGCATGG - Intergenic
978316403 4:107442278-107442300 TTCCATGTCAACTGTGTGCCAGG - Intergenic
985062494 4:186092925-186092947 GGCCATGGGAGTAGGGTGCCGGG + Intergenic
986182625 5:5407640-5407662 TGCCATCCCCATAGTGTTCCAGG - Intergenic
986517460 5:8579397-8579419 TGCCCTGGCAGTTGTGTGCAGGG + Intergenic
988894091 5:35653486-35653508 TGACCTGGCATTAATGTGCCTGG + Intronic
989421056 5:41240456-41240478 GGCCATGGCAGTAGGGTGGCGGG + Intronic
989657480 5:43760240-43760262 TGCCTGGGCAATGCTGTGCCGGG + Intergenic
993812069 5:92492835-92492857 TGCTATGTCAATAATCTGCCTGG + Intergenic
998387110 5:141763714-141763736 TGCCATGGCAACAGCCTCCCGGG - Intergenic
1000817927 5:165946654-165946676 TACCATAGAAAGAGTGTGCCTGG + Intergenic
1004288528 6:14345609-14345631 TCCCATGGCCATAGAGCGCCTGG + Intergenic
1004321799 6:14637528-14637550 TTGCATGGCAAGAGTGTGCAAGG - Intergenic
1012217806 6:96609814-96609836 TGCCATGGCCATAGTGAGCTAGG - Intronic
1016796293 6:148121465-148121487 TGACATGGCAACAGTGTCCCAGG - Intergenic
1022870301 7:34471455-34471477 GGCCATGGTAGTAGTGGGCCAGG + Intergenic
1024023550 7:45391896-45391918 TGCCATGGCAAATGTGGCCCAGG - Intergenic
1029227531 7:99038891-99038913 TGCCAAGAAAATACTGTGCCTGG + Intronic
1032889619 7:136180640-136180662 TGGCATGCCAATTATGTGCCAGG + Intergenic
1038199772 8:25401171-25401193 TGGCATGGAAATAGTGAGGCTGG + Intronic
1045254231 8:100506243-100506265 TGCCCTGGCAATGGTCTGCAAGG + Intergenic
1047809248 8:128390457-128390479 TTCCATGGCAACAGAGTGTCTGG + Intergenic
1050191972 9:3035793-3035815 TGCCACAGCACTAGGGTGCCAGG - Intergenic
1050472473 9:6007774-6007796 TGCCGGGGCATGAGTGTGCCCGG - Exonic
1051777111 9:20646957-20646979 TGCCGTGGCTATTGTCTGCCCGG - Intergenic
1051791334 9:20806084-20806106 TGACATGGCAAGAGTGGTCCAGG - Intronic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1058077111 9:100662357-100662379 TGCTCTGGCAATACTGTGCCTGG + Intergenic
1059699130 9:116758359-116758381 TGCCATGCCAGGAGAGTGCCAGG + Intronic
1060714775 9:125914992-125915014 TGACATGGCAATACAGTGCTGGG - Intronic
1062245143 9:135562304-135562326 CGCCATGGCCATGGAGTGCCAGG - Exonic
1192196812 X:69034097-69034119 TGCCATGGCAATGGCCTGCCAGG - Intergenic
1195345710 X:103949106-103949128 TCCTATGGCAAGAGTGAGCCCGG + Intronic
1198270319 X:135051136-135051158 TGCCAGGGCTTAAGTGTGCCTGG - Exonic
1202262850 Y:22987743-22987765 TTTCCTGGCAATAGTGTGCTTGG + Exonic
1202415840 Y:24621484-24621506 TTTCCTGGCAATAGTGTGCTTGG + Exonic
1202454947 Y:25048602-25048624 TTTCCTGGCAATAGTGTGCTTGG - Exonic