ID: 1056757521

View in Genome Browser
Species Human (GRCh38)
Location 9:89391234-89391256
Sequence CCAAGCGAAGCCAGAGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056757515_1056757521 4 Left 1056757515 9:89391207-89391229 CCAGGCACACTATTGCCATGGCA 0: 1
1: 1
2: 0
3: 10
4: 102
Right 1056757521 9:89391234-89391256 CCAAGCGAAGCCAGAGTGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 166
1056757513_1056757521 11 Left 1056757513 9:89391200-89391222 CCATCATCCAGGCACACTATTGC 0: 1
1: 0
2: 1
3: 10
4: 102
Right 1056757521 9:89391234-89391256 CCAAGCGAAGCCAGAGTGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 166
1056757511_1056757521 15 Left 1056757511 9:89391196-89391218 CCACCCATCATCCAGGCACACTA 0: 1
1: 1
2: 1
3: 15
4: 150
Right 1056757521 9:89391234-89391256 CCAAGCGAAGCCAGAGTGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 166
1056757512_1056757521 12 Left 1056757512 9:89391199-89391221 CCCATCATCCAGGCACACTATTG 0: 1
1: 1
2: 1
3: 7
4: 86
Right 1056757521 9:89391234-89391256 CCAAGCGAAGCCAGAGTGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056757521 Original CRISPR CCAAGCGAAGCCAGAGTGCC TGG Intronic
902038386 1:13474165-13474187 CAAAGCATAGCCACAGTGCCTGG + Intergenic
905307544 1:37029935-37029957 CCTAGTGAGGCCAGGGTGCCTGG + Intronic
907041912 1:51268828-51268850 CAAAGAGAAGCCAGAAAGCCAGG + Intronic
907571374 1:55487287-55487309 CTAGGAGAAGCAAGAGTGCCTGG - Intergenic
908512278 1:64858959-64858981 CCAAGGGAAGAGCGAGTGCCTGG + Intronic
912518604 1:110230709-110230731 CCAGATGAAGCCAGAGAGCCAGG - Intronic
913342565 1:117773352-117773374 CACAGAGAAGCAAGAGTGCCAGG - Intergenic
914701759 1:150140337-150140359 CAAACTGAAGCCAGATTGCCTGG + Intronic
916819609 1:168385675-168385697 CAACTCGAAGCCAGAATGCCTGG + Intergenic
917673847 1:177300819-177300841 CCAAATGAGGCAAGAGTGCCAGG + Intergenic
918983564 1:191595378-191595400 CCAACTGAAGCCAGCATGCCTGG - Intergenic
922134856 1:222814948-222814970 TCAAGCGAGGCCAGCGGGCCGGG + Intergenic
923707494 1:236356402-236356424 CCGGGCTAAGCCAGAGTGCCCGG - Intronic
1063455428 10:6179260-6179282 CAGAGGGAAGCCAGACTGCCAGG - Intronic
1064096691 10:12429135-12429157 TCAAGGCAAGCCAGAGTGGCAGG - Intronic
1065639441 10:27766923-27766945 ACAAGCGTAGTCAGGGTGCCTGG + Intergenic
1069030772 10:63593753-63593775 CCAAGAGAAGGCAGAGTGCCAGG + Intronic
1070245912 10:74731015-74731037 CCCAGCAAAGCCACAGGGCCAGG + Intergenic
1071465343 10:85934774-85934796 CCAGGCGTGGCCTGAGTGCCAGG + Intronic
1071852834 10:89592711-89592733 CCAAGGCCAGCCAGAGTCCCAGG - Intronic
1072951265 10:99848546-99848568 CCAGGTGAAGCCAGAGTGGCTGG - Intronic
1075414482 10:122252362-122252384 CCAGGGGAGGCCAGAGTGCCTGG + Intronic
1076670811 10:132120283-132120305 CCAAGCAGACCCAGAGTTCCTGG - Intronic
1078360268 11:10662586-10662608 CCAAGCGGAGCCAGAGGGGCTGG - Intronic
1080609455 11:33891620-33891642 GAAAGAGAAGCCAGAGTGCCCGG + Intronic
1082784316 11:57308614-57308636 CCAAGTGAAGCCAGGGAGCATGG - Exonic
1083462763 11:62825465-62825487 CCAAGGGCAGCCAGAGTGGCCGG - Exonic
1083611971 11:64008618-64008640 CCAAGAGAAGCTAGGGTGGCTGG - Intronic
1085226901 11:74929727-74929749 TCAAGCCAGGCCAGAGTGTCAGG - Intronic
1088797450 11:113275279-113275301 AGAAGCAAAGCCAGAGTGCCAGG + Exonic
1089787111 11:120915623-120915645 CCAAGGGAAGCCAGAGGACAGGG - Intronic
1096616673 12:52836971-52836993 CAACTGGAAGCCAGAGTGCCAGG - Intergenic
1096974750 12:55693691-55693713 CCAAGCAAAGGCAGAGTTCTAGG + Intronic
1101442379 12:104713379-104713401 CCAAGCTAAGCCAGTGTCCTGGG + Intronic
1102688397 12:114741856-114741878 ACACCCGAAGCCAGAGTCCCAGG + Intergenic
1103826506 12:123743283-123743305 TCAAGAGCAGCCAGAGGGCCTGG - Intronic
1104951643 12:132443490-132443512 CCCATGGAAGCCAGAGTGCCCGG - Intergenic
1106574220 13:30959055-30959077 ATAAGAGAAGCCAGACTGCCTGG - Intronic
1107421019 13:40246477-40246499 ACAAGGGAAGGCAGAGTGCATGG - Intergenic
1107975443 13:45683905-45683927 CCACGGGAAGCCAGTGTGTCTGG - Intergenic
1113023191 13:105911362-105911384 CCAAGCTCAGCCGGATTGCCTGG + Intergenic
1113439141 13:110314476-110314498 CCAAGCGAAGCCTGAGTAAAAGG + Intronic
1113630847 13:111882612-111882634 CCAAGTGAGGCCAGAGACCCAGG + Intergenic
1114645861 14:24255678-24255700 CCAGACGAGGCCAGAGTGCAGGG + Intronic
1117531293 14:56662849-56662871 ACAGGCGTAGCCAGGGTGCCCGG - Intronic
1118007158 14:61573692-61573714 CCAAGAGAAGTCAGCCTGCCTGG - Intronic
1118730533 14:68662955-68662977 CCAACTGAAGCCAGAGGGCAAGG - Intronic
1122686914 14:103513080-103513102 CCTGGCGAACCCAGAGAGCCTGG + Intergenic
1130113126 15:80982802-80982824 ACAAGGTAAGCCACAGTGCCTGG - Intronic
1134277412 16:12789095-12789117 CCAAGAGAATCCAGAAAGCCAGG - Intronic
1134514500 16:14875902-14875924 CTTAACGAAGCCAGAGTGCTGGG - Intronic
1134702177 16:16274555-16274577 CTTAACGAAGCCAGAGTGCTGGG - Intronic
1134969653 16:18520095-18520117 CTTAACGAAGCCAGAGTGCTGGG + Intronic
1135331466 16:21563466-21563488 CCAAGCTAAGACATAGAGCCAGG + Intergenic
1135435483 16:22424333-22424355 CCAAACGAGGCCTGAGAGCCCGG - Intronic
1135651246 16:24208650-24208672 CCAAGACAAGCCAGAGAGGCAGG + Intronic
1135665735 16:24334331-24334353 CCTAGCCCAGCCACAGTGCCTGG - Intronic
1136069969 16:27781841-27781863 CTAAGAGAAGCCAGACAGCCAGG + Intergenic
1136370852 16:29835099-29835121 ACTGGAGAAGCCAGAGTGCCTGG - Intronic
1137039173 16:35593870-35593892 CCCAGAGCAGACAGAGTGCCAGG - Intergenic
1137730246 16:50684208-50684230 CCCAGCTGAGCCAGAGTGACCGG + Intergenic
1138602221 16:58062912-58062934 CCAACAGAAGCCAGAGGGCAAGG - Intergenic
1140949782 16:79805879-79805901 CCATGCTAAGTCAGAGAGCCAGG + Intergenic
1141651932 16:85397402-85397424 CCAAGGCAAGGCAGAGTGCATGG + Intergenic
1142044684 16:87918138-87918160 CCAAACGAGGCCTGAGAGCCCGG - Intronic
1146538404 17:33673299-33673321 CCAAGAGAAGCCCAGGTGCCAGG + Intronic
1147258349 17:39195223-39195245 CCAAACCAAGCCAGAGAGGCTGG + Intronic
1147887841 17:43696707-43696729 AGAAACGGAGCCAGAGTGCCTGG + Intergenic
1148810602 17:50288458-50288480 CCAAGAGAAGCCAGATGGCTGGG - Intergenic
1149542425 17:57477690-57477712 CCAAGAGAAGGCAGTGTGCTAGG + Intronic
1150455711 17:65305050-65305072 CCAAGCGACCCCAAGGTGCCAGG + Intergenic
1150584274 17:66503230-66503252 CCCAGAGAAGCCAGAGTCACTGG - Intronic
1150871553 17:68917410-68917432 CCAAGGGAAGCTAAAGTGCGCGG - Exonic
1152278852 17:79373375-79373397 CCACGCCCAGCCCGAGTGCCTGG - Intronic
1152588449 17:81199458-81199480 CCCAGGGAGACCAGAGTGCCAGG - Exonic
1158705408 18:59788221-59788243 AGCAGAGAAGCCAGAGTGCCGGG + Intergenic
1160575112 18:79848806-79848828 CCCGGTGAAGCCAGACTGCCCGG + Intergenic
1163688432 19:18725374-18725396 CCAAGCGATGACAGAGAGCAAGG - Intronic
1165671763 19:37685658-37685680 TCAAGTGAAGCCAGACTGCCTGG + Intronic
1167144817 19:47675436-47675458 CCCAACGCAGCCTGAGTGCCTGG - Intronic
1167356949 19:49010231-49010253 CCATGCGAAGCTATAGTGCCAGG - Intronic
925099579 2:1233917-1233939 CCAAGTGAAGGCAGAGCGCTTGG - Intronic
925969595 2:9097012-9097034 CTCAGCGGAGCCGGAGTGCCAGG + Intergenic
927860153 2:26555681-26555703 CCAGGAGAAGGCAGAGAGCCTGG - Intronic
928230171 2:29491648-29491670 CCAAGAGAAACCAGAGGGACTGG - Intronic
930971076 2:57396909-57396931 CCTACCACAGCCAGAGTGCCTGG - Intergenic
931004824 2:57837082-57837104 CCAAGGGAAGCCAAAGCTCCTGG + Intergenic
932967755 2:76497755-76497777 CAAAGCAAAACCAGTGTGCCTGG - Intergenic
933683323 2:85122710-85122732 CCATGCGAAGACAGAATGCCAGG - Intergenic
937261382 2:120588545-120588567 CCAAGAGAAGCCAGAGACTCCGG - Intergenic
937297262 2:120817324-120817346 ACAAGCGCAGCCAGACTGCGGGG - Intronic
938953173 2:136275989-136276011 CCAAGTGAGGCCAAAGTGGCCGG - Intergenic
939366840 2:141244391-141244413 CCACGACAAGCCAGAGTTCCAGG - Intronic
941724468 2:168846045-168846067 TCAAGTGAAGCAAGAGTGACTGG - Intronic
946905485 2:224412229-224412251 CCAACCGAAACTAGCGTGCCTGG + Intergenic
947633854 2:231670353-231670375 CAAAGCTGAGCCACAGTGCCTGG - Intergenic
1169507402 20:6226567-6226589 TCAAGTGATGCCAGAGTTCCAGG - Intergenic
1169979766 20:11371334-11371356 CCAAGAGAGGGCAGAGTCCCAGG - Intergenic
1170890320 20:20369821-20369843 CCAAGCGAAGGCACAGTTCGGGG - Exonic
1172888962 20:38250212-38250234 GCAAGTGCAGCCAGACTGCCCGG + Intronic
1173858960 20:46269689-46269711 CCAAGAGGAGCCAGCCTGCCAGG + Intronic
1175227011 20:57450595-57450617 CCACAGGAAGCCAGAGAGCCAGG - Intergenic
1175243270 20:57565414-57565436 CCATGCTAAGCCAGTGGGCCAGG - Exonic
1177357671 21:20030629-20030651 CCCACCACAGCCAGAGTGCCTGG - Intergenic
1178910444 21:36669262-36669284 CCCAGAGAAGCCAGAGTGAGGGG - Intergenic
1179171313 21:38975194-38975216 CCCAGGGAAACCAGAGGGCCAGG + Intergenic
1179370491 21:40802111-40802133 CCAAGCAAAGCCACAGGGACAGG + Intronic
1180190169 21:46159107-46159129 CCAAGCCAAGCCCAAGAGCCTGG + Intergenic
1180594789 22:16966043-16966065 CTAAGCGAATGCAGAGTCCCTGG + Intronic
1182029882 22:27150188-27150210 CCTAGCTTAGCCAGAGAGCCTGG + Intergenic
1183493263 22:38127896-38127918 ACAGGTGAAGCCAGAGGGCCCGG + Intronic
950291942 3:11791781-11791803 ACAAACGAAGCCAGAGTGTCTGG - Intronic
950543128 3:13624169-13624191 AGAACGGAAGCCAGAGTGCCCGG - Intronic
951916365 3:27804960-27804982 TCAAGCGAACCTAAAGTGCCAGG - Intergenic
953904429 3:46861342-46861364 CCAAGCAAAGCCAGCCTGACTGG - Intronic
954199703 3:49016984-49017006 CCATGCGTAGCCTGAGTGGCTGG - Intronic
957842399 3:85688604-85688626 CCAAGCTAAGCTGGAGTGCAGGG + Intronic
961391089 3:126552754-126552776 CCAAGCTGAGCCCCAGTGCCAGG + Intronic
961447236 3:126986595-126986617 CCAAGCCAAGCCAGGGACCCAGG - Intergenic
962621602 3:137185750-137185772 CTAGGAAAAGCCAGAGTGCCTGG + Intergenic
964866672 3:161269952-161269974 ACAAGAGAAGCAAGAGAGCCTGG + Intergenic
966823451 3:183943364-183943386 CCAAGACATGCCAGAATGCCAGG - Intronic
967825387 3:193873304-193873326 CCAGGAGAAGCCAGGGTTCCTGG - Intergenic
968941927 4:3643429-3643451 TCAAACAAGGCCAGAGTGCCTGG - Intergenic
969042668 4:4312857-4312879 TGAAGAGCAGCCAGAGTGCCTGG - Intronic
969322098 4:6418531-6418553 CCTAGCGCAGCCAGAATGCTGGG - Intronic
976298708 4:83497873-83497895 TCAAGGAATGCCAGAGTGCCAGG + Intronic
979018809 4:115468431-115468453 CCCAGCAAAGCCACAGGGCCAGG + Intergenic
982452380 4:155569012-155569034 TCAATGGATGCCAGAGTGCCTGG + Intergenic
988479526 5:31618457-31618479 CCATGGGAAACCAGAGTGACAGG + Intergenic
988595311 5:32585615-32585637 CCGAGCGAAGCGTGAGTGCGCGG + Exonic
990613770 5:57486216-57486238 CCAAGTGAAGACAGAGAGGCAGG - Intergenic
991980048 5:72220938-72220960 GCAAGCGAAGCAGGAGTACCAGG - Exonic
992747194 5:79831455-79831477 CCAGGAGAAGCAGGAGTGCCTGG - Intergenic
998399620 5:141841739-141841761 CCAAGCCAAGCCAGGGAGCATGG + Intergenic
1000535231 5:162470744-162470766 CCAAGGAATACCAGAGTGCCAGG + Intergenic
1001102509 5:168825776-168825798 CCCTGCCAAGGCAGAGTGCCTGG - Intronic
1002709960 5:181189474-181189496 CCACGAGAAGACAGAGTTCCTGG - Intergenic
1003015081 6:2461894-2461916 CAGAGCGAACCCAGACTGCCTGG + Intergenic
1003051119 6:2782157-2782179 CAGAGCGTAGCCTGAGTGCCTGG + Intronic
1004183069 6:13397473-13397495 CCCAGAGATGCCAGAGGGCCTGG - Intronic
1004497857 6:16181292-16181314 CCAAGCGAAGTCAGGGTGCATGG - Intergenic
1006012441 6:31054178-31054200 CCGAGGGAAGCCAGAGCTCCGGG - Intergenic
1006831370 6:36970264-36970286 CCAGCGGAAGCCAGGGTGCCTGG + Intronic
1007114865 6:39336269-39336291 CCAGGCAAGGCCAGAGTGCTAGG - Exonic
1008381214 6:50841573-50841595 CTAAGAGAAGCCACAGTGCTTGG - Intronic
1015434835 6:133173391-133173413 CCCATCACAGCCAGAGTGCCTGG + Intergenic
1015781269 6:136868820-136868842 CCAAGTGAACCCAGAGGTCCTGG - Intronic
1016816302 6:148306254-148306276 CCAAAAGAAGCCAGAGAACCAGG + Intronic
1018001244 6:159580587-159580609 CCACGAGAACCGAGAGTGCCTGG + Intergenic
1019171639 6:170136364-170136386 CAGAGAGAAGCCAGCGTGCCGGG - Intergenic
1020358791 7:7305012-7305034 CCAAGGAAAGCCTGACTGCCAGG - Intergenic
1023689117 7:42768033-42768055 CCAAGCGCAGGAAGAGGGCCTGG + Intergenic
1025192514 7:56906900-56906922 ACAAGCCAAGCCACAGGGCCAGG + Intergenic
1025679432 7:63670022-63670044 ACAAGCCAAGCCACAGGGCCAGG - Intergenic
1029279109 7:99425309-99425331 CCTCCGGAAGCCAGAGTGCCCGG - Exonic
1034358928 7:150477203-150477225 CCAAGACCAGCCAGAGTGGCAGG + Exonic
1036820540 8:11936102-11936124 CCAAAGGAAGACAGAGTTCCTGG + Intergenic
1036911543 8:12761390-12761412 CCAGGAGAGGCCAGCGTGCCTGG - Intergenic
1042118097 8:65454569-65454591 CCAAGCCAAGCCAAGGGGCCTGG - Intergenic
1048096475 8:131300684-131300706 CCAACTGAAGCTGGAGTGCCTGG + Intergenic
1048945804 8:139446025-139446047 CAAAGGGAAGCCAGAGGGCATGG - Intergenic
1049027505 8:140005274-140005296 CCCAGAGAAGTCAGAGTCCCTGG - Intronic
1049482507 8:142833436-142833458 CCCAACTAAGGCAGAGTGCCAGG + Intergenic
1049483206 8:142837585-142837607 CCCAACTAAGGCAGAGTGCCAGG - Intronic
1056733494 9:89185152-89185174 CCATGGGAAGCCAGAGGTCCAGG + Intergenic
1056757521 9:89391234-89391256 CCAAGCGAAGCCAGAGTGCCTGG + Intronic
1057957811 9:99424806-99424828 CCTAGCCCAGCCAGAGGGCCTGG + Intergenic
1060811518 9:126613530-126613552 CCGAGCGAGGCCAGACTGCGCGG - Intergenic
1060995725 9:127874091-127874113 CCAGGCCAAGGCACAGTGCCAGG + Intronic
1061277368 9:129577092-129577114 CCAAGCCAGGCCGGAGTGCGTGG + Intergenic
1061907713 9:133707411-133707433 CCAAGCCAGGCCAAAGGGCCAGG + Intronic
1187819709 X:23274380-23274402 TCAAGAGAAGCCAGAGTTCTAGG - Intergenic
1189099307 X:38172522-38172544 CCAACCCAAGCCAGTGTGACAGG - Intronic
1189966977 X:46384981-46385003 CCACGCCAAGACAGATTGCCAGG + Intergenic
1191670713 X:63745794-63745816 CCAAGCCCAGCCATAGTGCTTGG - Intronic
1192171092 X:68855193-68855215 CCAGGCTCAGCCAGAGAGCCAGG - Intergenic
1193508733 X:82373265-82373287 CCAGGTGAAAGCAGAGTGCCTGG - Intergenic
1194536158 X:95107667-95107689 CAATGCTAATCCAGAGTGCCAGG - Intergenic
1197828177 X:130612957-130612979 CCAAGAGAAACCAAAGTGGCTGG - Intergenic
1200207404 X:154327054-154327076 GCAAGCAAAGACAGAGTTCCTGG - Intronic