ID: 1056757560

View in Genome Browser
Species Human (GRCh38)
Location 9:89391487-89391509
Sequence GCCGGCCAACACTACCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056757550_1056757560 23 Left 1056757550 9:89391441-89391463 CCAGAACACAGAGCTGGGGGACT 0: 1
1: 0
2: 2
3: 29
4: 197
Right 1056757560 9:89391487-89391509 GCCGGCCAACACTACCTTGGGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1056757555_1056757560 -7 Left 1056757555 9:89391471-89391493 CCCATGAGGTCACGAGGCCGGCC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1056757560 9:89391487-89391509 GCCGGCCAACACTACCTTGGGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1056757552_1056757560 -1 Left 1056757552 9:89391465-89391487 CCTGCACCCATGAGGTCACGAGG 0: 1
1: 0
2: 0
3: 5
4: 119
Right 1056757560 9:89391487-89391509 GCCGGCCAACACTACCTTGGGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1056757556_1056757560 -8 Left 1056757556 9:89391472-89391494 CCATGAGGTCACGAGGCCGGCCA 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1056757560 9:89391487-89391509 GCCGGCCAACACTACCTTGGGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1056757549_1056757560 24 Left 1056757549 9:89391440-89391462 CCCAGAACACAGAGCTGGGGGAC 0: 1
1: 0
2: 2
3: 27
4: 321
Right 1056757560 9:89391487-89391509 GCCGGCCAACACTACCTTGGGGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056757560 Original CRISPR GCCGGCCAACACTACCTTGG GGG Intronic
900892905 1:5462439-5462461 GAGAGCCAGCACTACCTTGGTGG + Intergenic
904058226 1:27686246-27686268 GCCACCCAACACTGTCTTGGTGG - Intergenic
920423905 1:205858055-205858077 GGGGGCCAACACTAGATTGGAGG - Intergenic
1073120487 10:101119672-101119694 GCCGGACAATTCTACCTTGATGG + Intronic
1083920650 11:65780177-65780199 GGCGGCCACCACTGCCCTGGCGG - Exonic
1094402870 12:30081236-30081258 GGTGGACAACAGTACCTTGGGGG + Intergenic
1103968431 12:124654720-124654742 ACTGGCCCAGACTACCTTGGGGG + Intergenic
1121745537 14:96287469-96287491 GCCGACCACCACTACGTTTGCGG + Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1124201927 15:27686198-27686220 TCAGCCCAACACTGCCTTGGTGG - Intergenic
1132605821 16:793343-793365 GCAGGCCAGCACTACCTTCGAGG + Intronic
1136138943 16:28276454-28276476 GCAAGCCAACACTGCCTGGGAGG - Intergenic
1146257293 17:31398937-31398959 ACTGGGCAACACTGCCTTGGAGG + Intronic
1161266581 19:3367160-3367182 GGCGGCCCGCACAACCTTGGTGG - Intronic
1161481541 19:4513261-4513283 GCCGGTCAGCACAGCCTTGGAGG + Exonic
932276597 2:70456391-70456413 GCAGGCCATCACCGCCTTGGTGG - Exonic
1172166471 20:32902782-32902804 TCAGGCCCACACTGCCTTGGAGG - Intronic
1174486316 20:50863607-50863629 GCCGGCCAACAAAACCTTCAAGG + Intronic
1174910296 20:54600809-54600831 GCAGGCAAACATTACCTTGCAGG + Intronic
1181494581 22:23280811-23280833 GCAGGACAACACTCCCTTTGGGG - Intronic
950499345 3:13353982-13354004 GCTGGCCAACACTGGCCTGGTGG + Exonic
960036931 3:113111275-113111297 GCCGGCCAACACCTCCTCTGGGG + Intergenic
961065849 3:123876727-123876749 CCCAGCCCAGACTACCTTGGTGG - Intronic
996342248 5:122451672-122451694 GTGGGCCCACACTACCTTGAGGG + Intronic
1001676322 5:173519577-173519599 GCTGGTCAACACTACCTGGCTGG + Intergenic
1013803216 6:113970544-113970566 GCCGGCCTACCCCGCCTTGGTGG - Intronic
1041649020 8:60282713-60282735 ACTGGCCAACATTAGCTTGGAGG + Intergenic
1044420850 8:91994131-91994153 CCTGGCCACCACTCCCTTGGGGG - Intronic
1051729868 9:20129979-20130001 GCAGGCCAAAACTACCTTCTAGG - Intergenic
1052824262 9:33163824-33163846 GCAGGCCTAAACTACCTGGGAGG + Intronic
1056757560 9:89391487-89391509 GCCGGCCAACACTACCTTGGGGG + Intronic
1060375258 9:123111109-123111131 AGCTGCCATCACTACCTTGGGGG + Intronic
1061446337 9:130640315-130640337 CCCAGCCGACCCTACCTTGGGGG - Intergenic