ID: 1056758581

View in Genome Browser
Species Human (GRCh38)
Location 9:89398410-89398432
Sequence GAAGTGGCTCTCAGCGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 916
Summary {0: 1, 1: 3, 2: 43, 3: 167, 4: 702}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056758581 Original CRISPR GAAGTGGCTCTCAGCGGAGA TGG (reversed) Intronic
900745404 1:4357284-4357306 GAAGGAGCTCTCAGCAGATAGGG - Intergenic
902006476 1:13236352-13236374 AATGTGGCTCTCAGTGGAAAGGG + Intergenic
902429788 1:16354050-16354072 GAAGTTGCAGTGAGCGGAGATGG - Intronic
902968411 1:20029151-20029173 GAAGTAGCTCTCAGCAGATGTGG + Intronic
903207699 1:21795284-21795306 GAAACAGCTCTCAGTGGAGAGGG + Intergenic
903621412 1:24700952-24700974 GAAGTGGATCTCAGCGGGTCTGG - Intergenic
904222499 1:28983992-28984014 AAAGTGGCTCTCAGCGGGAAGGG + Intronic
904325770 1:29726908-29726930 GAAGGGGCTTTCAGGGCAGAAGG + Intergenic
904346664 1:29876856-29876878 GAAGTGGCTCTCAGCAGAAGGGG - Intergenic
904449410 1:30601328-30601350 AAAATGGCTTTCAGCAGAGAGGG - Intergenic
904526312 1:31136413-31136435 GAAGTGGCTCTCAGCGGGATGGG - Intergenic
904577989 1:31517791-31517813 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
905071765 1:35232387-35232409 GAGGTTGCTATCAGCCGAGATGG + Intergenic
905522296 1:38609522-38609544 TGGGTGGCTCTCAGCGGAAAGGG + Intergenic
905558704 1:38908930-38908952 GAAGTAGCTCTCAGCAGATGGGG + Intronic
905767043 1:40610015-40610037 AAAGTGGCTCTCAGTGGGAAGGG - Intergenic
905899881 1:41574472-41574494 GCAGGGGCTCTCAGGAGAGAGGG - Intronic
905927478 1:41762224-41762246 AAAATAGCTCTCAGCAGAGAGGG - Intronic
907263067 1:53236667-53236689 GAGGAGGCTCGCAGCAGAGAAGG - Intronic
907615953 1:55926966-55926988 AAAACGGCTCTCAGTGGAGAGGG - Intergenic
907706784 1:56839392-56839414 GAAGTGGTTCTCAGTGGGAAAGG + Intergenic
908059621 1:60333477-60333499 GAAGTGGCTCTCAGTGGGGTGGG - Intergenic
908207936 1:61870198-61870220 AAAGTGGCTCTCAGTGGGAAGGG + Intronic
908229209 1:62087176-62087198 GAAGTGGCTGTCAGTGGAGAGGG + Intronic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
909775409 1:79478699-79478721 GAGGTGGCTCTCAGTGGGAAGGG + Intergenic
909920942 1:81379528-81379550 GAAGTAGCTTTCAGCAGATAGGG + Intronic
910050950 1:82973464-82973486 GAAGTAGCTCTCAGCCGATGGGG - Intergenic
910150246 1:84134009-84134031 GAAGTGGCTCTCAGCGGGAAAGG + Intronic
911205708 1:95090025-95090047 AAAGTGGCTCTCAGAGGGAAGGG + Intergenic
911546620 1:99225053-99225075 GAAGTGGCTCTCAGTGGGAAGGG + Intergenic
911587224 1:99704896-99704918 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
911831421 1:102554836-102554858 GAAGTGGCTCTCAGCCAGAAGGG - Intergenic
914977280 1:152378172-152378194 GAAGTAGCTCTCAGCTGATGTGG + Intergenic
916900293 1:169215098-169215120 AAAGTAGCTCTCAGTGGAAAGGG + Intronic
917539427 1:175898661-175898683 GAAGTGGCTCTCAGCGGTATGGG - Intergenic
917589189 1:176459619-176459641 GAAGTGGCTCTCAGCAGGATGGG + Intergenic
917725113 1:177820824-177820846 GAAGTGGGTCTGAGCTGGGAAGG - Intergenic
918910555 1:190562980-190563002 AAATTGGCTGTCAGTGGAGAGGG - Intergenic
919162797 1:193853404-193853426 AAAGAGGCTCTCAGCAGGGAGGG - Intergenic
919314558 1:195954830-195954852 GAAGTGGCTCTCAGTGGGAAGGG - Intergenic
919861996 1:201745895-201745917 GAGGTGGCAATGAGCGGAGATGG - Intronic
920203585 1:204275646-204275668 CAGGAGGCTCTCAGGGGAGATGG + Intronic
920548584 1:206839076-206839098 TAACTGGCTCTCAGGGCAGATGG + Intronic
921092195 1:211854964-211854986 GAAGTAGCTCTCAGCTGATGGGG + Intergenic
921680022 1:218020456-218020478 AAAGTGGCTCTCAGCAGGAAGGG - Intergenic
921785909 1:219229445-219229467 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
922076880 1:222253828-222253850 AAAGTGGCTCTCAGCTGGAAGGG - Intergenic
922273140 1:224052944-224052966 GAAGTAGACCTCAGCGGAAAAGG - Intergenic
922334064 1:224604903-224604925 AAAATGGCTTTCAGAGGAGAGGG + Intronic
922700064 1:227754096-227754118 GAAGTAGCTCTCAGCAGATGGGG + Intronic
922809674 1:228408579-228408601 GTAGTGCCTCCCAGAGGAGAAGG + Exonic
922868915 1:228884236-228884258 GAAACGGCTTTCAGTGGAGAGGG - Intergenic
923023700 1:230187726-230187748 GAAGTGGCTCTCAGTGGGATGGG + Intronic
923306601 1:232694261-232694283 AAAGTGGCTCTCAGCGGGATGGG - Intergenic
923443111 1:234040105-234040127 GAAGTGGCTCTCAGTGGAGAAGG + Intronic
923944268 1:238864964-238864986 AAAGTGGCTCTCAGCAGGAAGGG + Intergenic
924319905 1:242838643-242838665 AAGATGGCTCTCAGCAGAGAGGG - Intergenic
924804711 1:247353054-247353076 AAAGTGGCTCTCAGTGGCAAAGG - Intergenic
1062803328 10:396023-396045 CAAGGGGCTCTCAGCTGAGGGGG + Intronic
1063085931 10:2817760-2817782 GAAGGGGCTCTCAGTGTTGATGG + Intergenic
1063239010 10:4149259-4149281 GAAGTAGCTCTCAGCGGATGGGG + Intergenic
1063304150 10:4880978-4881000 AAAATGGCTTTCAGCAGAGATGG - Intergenic
1063357743 10:5417034-5417056 GAAGTAGCTCTCAGCAGATGGGG + Intronic
1064329820 10:14383142-14383164 GAACTGGCTCTCTCGGGAGAGGG + Intronic
1064623808 10:17241778-17241800 GAAGTGGCCCTCACCAGACACGG + Intergenic
1065009144 10:21405982-21406004 GATGTGGCTCTCAGTGGAATGGG - Intergenic
1065009368 10:21407692-21407714 AAAGTGGCTCTCAGTGGAAGGGG + Intergenic
1066193823 10:33079568-33079590 GAACTGGAGCTCAGAGGAGAGGG - Intergenic
1066272538 10:33837560-33837582 GAAGTGGCTCTCAGCAGAAGGGG - Intergenic
1067120938 10:43471608-43471630 AAAATGGCTCTCAGCAGAGAGGG + Intronic
1067148624 10:43711669-43711691 GAGGTGGCACTCAGGGGTGAAGG + Intergenic
1067266286 10:44748260-44748282 GAAATGGCTTTCAGCAAAGAGGG + Intergenic
1067350863 10:45474406-45474428 GCAGAGGCTCACAGCAGAGATGG + Intronic
1068015915 10:51516159-51516181 AAAGTGGCTCTCAGGAGAGAAGG + Intronic
1068134683 10:52940146-52940168 GAAGTAGCTCTCAGCCGATGGGG - Intergenic
1068178085 10:53487516-53487538 AAAGTGGCTCTCAGTGGGAAGGG + Intergenic
1068318843 10:55383117-55383139 GGAGTGGCTCTCAGTGGAAGGGG + Intronic
1068607927 10:59026292-59026314 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1068904420 10:62307263-62307285 AAAGTGGCTCTCAGTGGGAAGGG + Intergenic
1069137797 10:64785736-64785758 GAAGTGGTTCTCAGTGGGAAAGG - Intergenic
1069247176 10:66220668-66220690 GAAGTGGCTCTCAGCAGGATGGG + Intronic
1069769891 10:70891524-70891546 GAAACAGCTCTCAGTGGAGAGGG + Intergenic
1069964718 10:72105021-72105043 GAAATGGCTCTCAGCAGACATGG - Intronic
1070204475 10:74242910-74242932 GAAATGGCTCTCAGTGGAGAGGG - Intronic
1070284284 10:75072062-75072084 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1071149768 10:82620385-82620407 GAAATGGCTCTCGGCAGAGAGGG + Intronic
1071152589 10:82652388-82652410 AAAGTGGCTCTCAGCAGGAAGGG + Intronic
1071353212 10:84767406-84767428 GAAGTAGCTCTCAGCAGATGCGG + Intergenic
1071486854 10:86107890-86107912 GGAGTGGCTCTCAGCAGATGGGG - Intronic
1072279222 10:93850940-93850962 AAAGTGGCTCTCAGCAGGAAGGG - Intergenic
1073268090 10:102240602-102240624 GAAGTGGGTCTCTCCGGAGCGGG - Intronic
1073728805 10:106267418-106267440 GAAATGTCTCTCAGTGGAGTGGG - Intergenic
1074028621 10:109663116-109663138 GAAGTGGCACTCAGAAGGGATGG - Intergenic
1074378275 10:112956926-112956948 GAGGTGGGGGTCAGCGGAGAAGG - Intronic
1075002288 10:118807743-118807765 GAAGTGGCCCTCACCAGACATGG + Intergenic
1075943810 10:126414529-126414551 CTAGTGGCTCTCAGAGGAGCTGG + Intergenic
1075975626 10:126691671-126691693 GAAGTGGCTCTCAGTGGGATGGG + Intergenic
1076897287 10:133318866-133318888 GAACTGACACCCAGCGGAGAAGG - Intronic
1078246899 11:9581926-9581948 GAAGTTGCAGTGAGCGGAGATGG - Intronic
1078467639 11:11561942-11561964 GCAGTGGCTCACAGGGGTGAAGG + Intronic
1078696335 11:13635857-13635879 GAAGAGGCTCTCAGGGGTGATGG + Intergenic
1079898391 11:26150094-26150116 AAAGTGGCTCTCAGCAGGAAGGG + Intergenic
1080604404 11:33852874-33852896 GAGATGGCTCTCAGTGGAGAGGG + Intergenic
1080961650 11:37167986-37168008 GAAGTGGCTCTATGGGGAGTTGG - Intergenic
1081038178 11:38176705-38176727 AAAGAGGCTCTCAGTGGAGAGGG - Intergenic
1081329997 11:41790767-41790789 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1081874941 11:46402051-46402073 GAAGTGGGTGGCAGAGGAGATGG - Intronic
1081977047 11:47242337-47242359 GAGGTGGCTCTCAGAGGTCATGG + Intronic
1082645536 11:55720084-55720106 AAAGCTGCTCTCAGTGGAGAGGG + Intergenic
1082663828 11:55949357-55949379 AAAATGGCTCTCAGGGGAGAGGG - Intergenic
1082809890 11:57473545-57473567 GCAGAGGCTCTCAGCCCAGAGGG + Intronic
1083363537 11:62128005-62128027 GGAGTGGCTGTGAGCAGAGAGGG + Intronic
1085270578 11:75267521-75267543 GAGGTGGCTCTCAGCAGACGGGG + Intronic
1086001856 11:81993100-81993122 GAAGTAGCTCTCAGTAGATAGGG - Intergenic
1086002114 11:81996438-81996460 AAAGTGGCTCTCAGTGGAGAAGG + Intergenic
1087328009 11:96746867-96746889 GAAGTGGCTCTCAGCAGGTGGGG - Intergenic
1087439242 11:98161647-98161669 GAGGTGGCTCTCAGAGGAAGGGG - Intergenic
1087461407 11:98453399-98453421 GAAGTAGCTCTCAGCAGACGGGG + Intergenic
1087575584 11:99985292-99985314 GAAATGGTTCTCAGCAGACAGGG + Intronic
1087602973 11:100339339-100339361 AAAATGGCTCTCAGTGGAGAAGG + Intronic
1087608416 11:100405375-100405397 GAAGTGGCTCTCAGTGGGAAGGG + Intergenic
1087973835 11:104518999-104519021 GAAGTTGCGGTCAGCCGAGATGG + Intergenic
1088133838 11:106529082-106529104 GGAACAGCTCTCAGCGGAGAGGG - Intergenic
1088390804 11:109312809-109312831 GTGCTGGCTCTCAGAGGAGAAGG + Intergenic
1088704252 11:112447727-112447749 GAGGTTACTCTCAGCAGAGAGGG + Intergenic
1089603590 11:119629055-119629077 GAAGGGGCTCTCAGAGCAGGAGG + Intronic
1089611109 11:119669748-119669770 GAAGTGGCTTTCAGGGGGCAGGG - Intronic
1089949231 11:122509968-122509990 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1090136152 11:124201017-124201039 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1090678918 11:129032012-129032034 GAAGTGGCTCTCAGAGGGATGGG - Intronic
1092429806 12:8399207-8399229 CAACTGGCTCTCAGCGGATGGGG - Intergenic
1092491910 12:8953212-8953234 GGAACAGCTCTCAGCGGAGAGGG + Intronic
1092569079 12:9702221-9702243 GAAGTGGCTCTCAGCGGGATAGG + Intergenic
1092680071 12:10969092-10969114 GAAGTGACTCTCAGCAGGAAGGG + Intronic
1092955620 12:13546930-13546952 TGAGTGGCTCTTAGTGGAGAGGG - Exonic
1093059344 12:14587388-14587410 GAAGGGGCTCTTAGAGGAGGTGG + Intergenic
1093300833 12:17452367-17452389 GAAGTGGCTGTCAGTGGGAAGGG + Intergenic
1093654358 12:21677568-21677590 GAAGTAGCTCTCAGCAGATGGGG - Intronic
1093655969 12:21694677-21694699 GAAGTAGCTCTCAGCAGATGAGG + Intronic
1093731228 12:22568025-22568047 AAAGCAACTCTCAGCGGAGAGGG + Intergenic
1093751394 12:22804204-22804226 GAAGTGGCTCTCAGCAGGATAGG + Intergenic
1093755801 12:22850699-22850721 AAAGTGGCTTTCAGCAGAGAAGG + Intergenic
1093767582 12:22982538-22982560 AAAGTGGCTCTCAGCGAGAAGGG - Intergenic
1093937754 12:25019392-25019414 GAAGTGGCTCTCAGCAGGATGGG + Intergenic
1094191803 12:27705793-27705815 GAAAAAGCTCTCAGCCGAGAGGG + Intergenic
1094647264 12:32337795-32337817 GCAGTGGCACTCAGAGGAAAAGG + Exonic
1095898616 12:47305478-47305500 GAAGTGGCTCTCAGCAAATGGGG + Intergenic
1096967846 12:55642847-55642869 GAAGTGGCTTCCAGCAGAGGAGG - Intergenic
1096976314 12:55700936-55700958 GTAGTGGCTATCAGGGGAGAAGG + Exonic
1097274164 12:57800670-57800692 GAAGTTGCTGTGAGCTGAGATGG - Intronic
1097305999 12:58069521-58069543 GCAGTAGATCTCAGTGGAGAGGG + Intergenic
1097449367 12:59716779-59716801 GAAGTTGCTGTGAGCTGAGATGG + Intronic
1097746599 12:63310475-63310497 GGAGTGGCTCTCAGCAGAGAGGG + Intergenic
1098538428 12:71622290-71622312 AAAGTGGGTCTCATCAGAGATGG - Intronic
1098545608 12:71707855-71707877 GAAGTGGCTCTCAGTGGGAAGGG + Intergenic
1098703135 12:73653830-73653852 GTAGTAGCTCTCAGAGTAGATGG - Intergenic
1099425469 12:82518274-82518296 GAAGTGGCTCTCAGCAGGATGGG + Intergenic
1099534060 12:83824029-83824051 AAAATTGCTCTCAGCAGAGAGGG + Intergenic
1099540776 12:83904782-83904804 GAGGTGGCTCTCAGCAGAAGGGG + Intergenic
1099543858 12:83951068-83951090 AAAGTGGCTCTCAGCGTGAAGGG - Intergenic
1100072587 12:90738063-90738085 GGAGCAGCTCTCAGTGGAGAGGG - Intergenic
1100113500 12:91273872-91273894 GAAGTGGCTCCCAGGAAAGATGG + Intergenic
1100594561 12:96060833-96060855 AAAGTGGCTCTCTGCAGAAAGGG + Intergenic
1100641295 12:96484434-96484456 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1100757940 12:97773052-97773074 GAAGTGGCTCTCAGTGGGAAGGG + Intergenic
1100966636 12:100020612-100020634 GCCGTGGTTCTCAGCTGAGAGGG - Intergenic
1101455765 12:104828306-104828328 GAAGTAGCTCTCAGCAGATGGGG - Intronic
1101469602 12:104984234-104984256 GATGTGGCTCTCAGTGGAATGGG + Intergenic
1101550253 12:105754775-105754797 GAGGTGGCTCTCAGCTGAATGGG + Intergenic
1102086921 12:110149595-110149617 GAAGTAGCTTTCAGCAGATAGGG + Intronic
1102165511 12:110803408-110803430 TAAGTAGATCTCAGAGGAGAAGG - Intergenic
1102406534 12:112678736-112678758 GGTGTGGCGCTCAGAGGAGATGG + Intronic
1102566898 12:113802921-113802943 GCACTGGCTCTCAGCCGGGATGG + Intergenic
1102910557 12:116710604-116710626 GAAGTTGGTCCCAGCAGAGAAGG + Exonic
1103419332 12:120767575-120767597 GAAGTGGCTGCCAGTGGAGCTGG + Exonic
1103674405 12:122644360-122644382 TAAGTAGCTCTCAGCAGATAGGG + Intergenic
1104143126 12:126007135-126007157 GAAGTGGCTCTCAGCAGGATGGG + Intergenic
1104307418 12:127621955-127621977 GAAACAGCTCTCAGCAGAGAGGG + Intergenic
1104463014 12:128970316-128970338 GAAGTGGGGCTCAGGGGAGAGGG - Intronic
1104791417 12:131484250-131484272 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1104833695 12:131772880-131772902 GAAGTGGCTCTCAGCAGAAAGGG + Intronic
1105202192 13:18190341-18190363 GAGGTGGCTCTCAGCGTAGGAGG + Intergenic
1105594949 13:21828349-21828371 GAAGTAGCTCTCAGCAGATGAGG - Intergenic
1105639740 13:22249992-22250014 AAAGTGGCTCTCAGTGGGAAGGG - Intergenic
1105724436 13:23147757-23147779 GAAGTAGCTCTCAGCAGATAAGG + Intergenic
1105765691 13:23556350-23556372 GAAGTTGCTGTGAGCCGAGATGG + Intergenic
1106240144 13:27905411-27905433 GAAGTGCGTCTAAGAGGAGAAGG - Intergenic
1106627377 13:31434453-31434475 GAAGTGGCTCTCAGCAGAAAGGG + Intergenic
1106933904 13:34697088-34697110 AAAACGGCTTTCAGCGGAGAAGG + Intergenic
1107037055 13:35912609-35912631 GAAGTTGCTCTCAGCAGAGAGGG - Intronic
1107294394 13:38894337-38894359 GAAGTGGCTCTCAGCAGATGGGG - Intergenic
1107911115 13:45106631-45106653 GAAATGCCTCTCAGCAAAGAGGG + Intergenic
1108958489 13:56189847-56189869 AAAGTGGCTCTCAGTGGGAAGGG - Intergenic
1109006699 13:56886385-56886407 GAAGTGGCTTTCAGCGGAAGGGG - Intergenic
1109152426 13:58860898-58860920 GAAGTAGCTCTCAGCAGATCAGG + Intergenic
1109420027 13:62099970-62099992 AAAGTGGCTCTCAGCAGGAAGGG - Intergenic
1109595511 13:64548728-64548750 TAAGAGGCTCTCAGAGGAGAAGG - Intergenic
1109784550 13:67156571-67156593 GAAGTAGCTCTCAGCAGATGGGG - Intronic
1109883035 13:68506982-68507004 AAAGTGGCTCTCGGCAGAGAGGG - Intergenic
1110363801 13:74659152-74659174 AAAGTGGCTCTCACTGGAGCAGG - Intergenic
1110582885 13:77152738-77152760 GAAGTGGCTCTCAGCAGAAGGGG - Intronic
1111034904 13:82659626-82659648 GAAGTGCCTCTCAGCAGAAAGGG - Intergenic
1111103963 13:83622018-83622040 AAAGTGGCTCTCAGCAGGAAGGG - Intergenic
1111168293 13:84491717-84491739 AAAGTGGCTCTCAGTGGGAAGGG - Intergenic
1111235814 13:85406171-85406193 AAAGTGGCTCTCAGCAGGAAGGG + Intergenic
1111292760 13:86188818-86188840 GAAGTAGCTCTCAGCCGATGGGG - Intergenic
1111309975 13:86471928-86471950 GAAACGGCTCTCAGCAGAGAGGG + Intergenic
1111491642 13:88984240-88984262 GAAGTTGCTGTGAGCCGAGATGG + Intergenic
1111607857 13:90563942-90563964 GAAGTGGCTCTCAGCAGGGAGGG - Intergenic
1111726248 13:92013269-92013291 GAAATGGCTCTCAGCAGAGAGGG + Intronic
1114345453 14:21789833-21789855 GAAGTGGCGCTCAGTGGAAGGGG - Intergenic
1115153735 14:30314971-30314993 GAAATGGCTCTCAGTGGGAAGGG - Intergenic
1115245162 14:31287237-31287259 GAAGTGGCTCTCAGTGGGAAGGG + Intergenic
1115574018 14:34693588-34693610 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1116296181 14:43113468-43113490 GAAAAAGCTCTCAGCAGAGAGGG + Intergenic
1116345371 14:43786435-43786457 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1116523807 14:45880464-45880486 GAGGTGGCTCTCAGCAGAAAGGG - Intergenic
1116526357 14:45910605-45910627 GAAGTGGCTCTCAGCAGAAGGGG - Intergenic
1116646497 14:47535565-47535587 GAAGTGGCTCTGAGTCGGGAAGG + Intronic
1116716349 14:48431370-48431392 AGAGTGGCTCTCAGTGGAGAGGG + Intergenic
1117450557 14:55845688-55845710 GAAGTGGCTCTCAGTGGGAAGGG + Intergenic
1118082057 14:62372228-62372250 GAAGTGGCTATCAGCTGGAAAGG + Intergenic
1118240034 14:64047161-64047183 AAAATGGCTCTCAGTGGAGAGGG + Intronic
1118929348 14:70225660-70225682 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1119021686 14:71121602-71121624 GAAATGGTTCTCAGTCGAGAGGG - Intergenic
1119137949 14:72238050-72238072 GGAGTGGCTCTCAGTGGAAAGGG + Intronic
1119252476 14:73168658-73168680 GAAGTGGTTCTCAGCAGAATGGG - Intronic
1119562677 14:75603475-75603497 GAAGTGGCTGTCAGTGGGAAGGG - Intronic
1119777780 14:77259145-77259167 GAAGTGGCTGGCAGAGGAGTGGG - Exonic
1119913321 14:78371389-78371411 GAAGTGGCTCTCAGCAGAAGGGG - Intronic
1120474476 14:84969875-84969897 GAAATGGCTCTCAGTGGGAAGGG + Intergenic
1120493389 14:85204599-85204621 AAAGTGGCTCTCAGAGGAAGGGG - Intergenic
1120614694 14:86688831-86688853 AAAGTGGCTCTCAGTGGAAGGGG - Intergenic
1120745282 14:88146450-88146472 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1121145604 14:91579484-91579506 GAAGTGGCTCTCGGCAGGAAGGG - Intergenic
1121475643 14:94199615-94199637 GAAGTAGCTCTCAGCAGATGGGG + Intronic
1121908254 14:97767006-97767028 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1122217637 14:100214491-100214513 GCAGCGGCTCTCGGCGCAGAGGG + Intergenic
1122424226 14:101596334-101596356 GAAGTGGGTCTGAGCGGTGGAGG + Intergenic
1122424233 14:101596368-101596390 GAAGTGGGTCTGAGCGGTGGAGG + Intergenic
1122449507 14:101793811-101793833 AAAGTGGCTCTCAGTGGGAAGGG + Intronic
1122708147 14:103634589-103634611 GGAGTGGGTCTAAGAGGAGAGGG + Intronic
1122831490 14:104399446-104399468 GAAGCTGCTCTCCGGGGAGAAGG - Intergenic
1123002840 14:105305506-105305528 GAAGTGGCCCTCACCAGACACGG + Exonic
1123824011 15:24063066-24063088 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1124054364 15:26228249-26228271 GGAATGGCTCTCAGTGCAGAGGG + Intergenic
1126088348 15:45029778-45029800 AAAATGGCTTTCAGCAGAGAAGG + Intronic
1126212104 15:46111496-46111518 GAGGTGGCTCTCAGTGGGAAAGG - Intergenic
1126984105 15:54282798-54282820 AAAACAGCTCTCAGCGGAGAGGG + Intronic
1128579947 15:68802715-68802737 GAAGTTGCGCTGAGCCGAGATGG - Intronic
1129019620 15:72504476-72504498 AAAATGGCTCTTAGCAGAGAGGG + Intronic
1129147617 15:73663124-73663146 AAAGTGGCTCTCAGTGGGTAGGG + Intergenic
1129886771 15:79043680-79043702 GAAGTGGCTACCTGGGGAGATGG + Intronic
1130134337 15:81169445-81169467 AAAGTGGCTCTCAGTGGGAAGGG - Intronic
1130594186 15:85237508-85237530 GTAGTGGCTTTCAGTGCAGAAGG - Intergenic
1131885506 15:96907780-96907802 GAAATGGCTCTCAGTGGAAGGGG + Intergenic
1133354136 16:5123607-5123629 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1133467527 16:6042163-6042185 GAAGTTGCAGTCAGCCGAGATGG - Intronic
1133695652 16:8260080-8260102 GAAGTGGCTCTCAGCAGAAAGGG - Intergenic
1134123495 16:11600795-11600817 AAAACGGCTTTCAGCGGAGAGGG - Intronic
1134346648 16:13397912-13397934 GAAGTAGCTCTCAGCAGAGCGGG + Intergenic
1134602325 16:15543101-15543123 GAAGTGGCTCTCAGTGGAAGGGG + Intronic
1135257028 16:20949026-20949048 AAAGTGGCTCTCAGCGGGAAAGG - Intronic
1135672505 16:24387278-24387300 GAAGTGGCTCTCAGTGGGATGGG + Intergenic
1135678397 16:24436713-24436735 GATGTGGCTCTCAGCAGAATGGG - Intergenic
1136404255 16:30034660-30034682 GCACTGGCCCTCAGCAGAGAAGG + Intronic
1137853832 16:51773420-51773442 GAAGTAGCTCTCAGCAGACGGGG - Intergenic
1138128328 16:54456966-54456988 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1138152329 16:54670228-54670250 GAAACAGCTCTCAGCAGAGAGGG + Intergenic
1138808494 16:60121002-60121024 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1138936940 16:61738077-61738099 GAAGTGGCTCTCTCAAGAGAGGG + Intronic
1139170883 16:64628034-64628056 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1139564240 16:67763369-67763391 ACAGTGGCTGTCAGCAGAGATGG + Intronic
1139650093 16:68357893-68357915 AAAGTGGCTGTCAGGGGAGCTGG + Exonic
1139739772 16:69025301-69025323 GAAACGGCTCTCAGCAGAGAAGG + Intronic
1139821142 16:69722226-69722248 GAAGTTGCTGTAAGCCGAGATGG - Intronic
1140002503 16:71039716-71039738 AAAGTGGCTCTCAGGGGGAAAGG - Intronic
1140324783 16:73991199-73991221 GAAGTGGCTCTCAGCAAGAAGGG + Intergenic
1140550097 16:75856282-75856304 GAAGCGACTCTCAGTGGAGAGGG - Intergenic
1141359705 16:83384286-83384308 GAGGTGGCAGTCAGCAGAGATGG - Intronic
1142281354 16:89149649-89149671 GAAACAGCTCTCAGCGGAGAGGG + Intronic
1143201857 17:5118735-5118757 ACAGTGGCTCTCAGCGGAGAGGG + Intronic
1143292357 17:5840943-5840965 GAAGTAGCTCTCAGCAGATGGGG + Intronic
1143706771 17:8703528-8703550 GAAACAGCTCTCAGTGGAGAGGG + Intergenic
1143726112 17:8847736-8847758 GAAGTTGCAGTCAGCCGAGATGG + Intronic
1144423174 17:15116321-15116343 GAAACAGCTCTCAGCAGAGAGGG - Intergenic
1144820677 17:18071484-18071506 GAAGTAGCTGTCAGGGGAGTGGG + Intergenic
1146886756 17:36475956-36475978 AAAGTGGCTCTCAGAGGGAAGGG + Intergenic
1146958315 17:36950198-36950220 GCAGTGGCTGTCGGGGGAGAGGG - Exonic
1147230182 17:39012014-39012036 AAAGTGGCTCTCAGTGGGAAGGG - Intergenic
1147533098 17:41298607-41298629 GAAGTAGCTCTCAGCAGACGGGG - Intergenic
1148040407 17:44702267-44702289 GAAGTGGCAGTGAGCTGAGATGG - Intergenic
1148055970 17:44795930-44795952 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1148892976 17:50820992-50821014 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1149132170 17:53316104-53316126 GAAGTAGCTCTCAGCAGACAGGG + Intergenic
1149482889 17:57017866-57017888 TCTGTGGCTCTCAGCAGAGAGGG + Intergenic
1149813256 17:59698361-59698383 GCAGTGGTTCTCAGTGGAGATGG + Exonic
1150686467 17:67325124-67325146 AAAGTGGCTCTCAGCAGGAAGGG - Intergenic
1150932086 17:69596019-69596041 GAAATGGCTCTCAGCAGAGAGGG - Intergenic
1150935448 17:69630440-69630462 GCATTGGCTCTCAGAGGAGCAGG + Intergenic
1151018490 17:70584789-70584811 AAAATGGCCCTCAGTGGAGAGGG + Intergenic
1151533196 17:74720871-74720893 GAAGTGGCTCTCAGTGGAAGGGG + Intronic
1152073414 17:78145173-78145195 GCAGTGGCCCACAGCGGAGCTGG + Intergenic
1152442568 17:80317955-80317977 GAAATGGCTCTCCATGGAGAGGG + Intronic
1152498607 17:80693330-80693352 AGAGTTGCTCCCAGCGGAGATGG + Intronic
1153158799 18:2179675-2179697 GAGGTGGCTCTCAGCAGGAAGGG - Intergenic
1153450018 18:5216743-5216765 GAAGAAGCTGTCAGAGGAGAAGG - Intergenic
1153703957 18:7725757-7725779 AAAGTGGCTCTCAGCGCGAAGGG - Intronic
1153710497 18:7794079-7794101 GAAGTAGCTCTCAGCAGATGGGG - Intronic
1153713067 18:7819540-7819562 GAAGTAGCTCTCAGCAGATGGGG - Intronic
1153990477 18:10394713-10394735 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1154384458 18:13880582-13880604 GAAATGGCTCTCAGTGGACAGGG - Intergenic
1155017865 18:21863449-21863471 GAAATGGCTCTCAGCAGAGAGGG + Intronic
1155164637 18:23222301-23222323 GAAGGGGCTCTTAGTGGAGCTGG - Intronic
1155310452 18:24518063-24518085 AAAATGGTTCTCAGTGGAGAGGG + Intergenic
1155637784 18:27975842-27975864 AAAGCAGCTCTCAGCAGAGAGGG + Intronic
1155639740 18:27999084-27999106 GAACTGGCTCTCAGAGGGTAAGG + Intronic
1155799966 18:30089395-30089417 GGAATGGCTCTCAGTAGAGAAGG - Intergenic
1155807116 18:30185169-30185191 AAAGTGGCTCTCAGAGGGAAGGG - Intergenic
1155840204 18:30633605-30633627 GATATGGTTCTCAGTGGAGAGGG + Intergenic
1156216307 18:35001447-35001469 GAAGTTGCAGTCAGCAGAGATGG + Intronic
1156311534 18:35926848-35926870 GAAGTGGCTCTCAGTGGGATGGG - Intergenic
1156551911 18:38027404-38027426 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1156905606 18:42348668-42348690 GGAATGGCTCTCAGCAGAGAGGG - Intergenic
1156946908 18:42844450-42844472 GAAGTGGTTCTCAGTGTAGAAGG + Intronic
1157116866 18:44870266-44870288 GATGTGGCTCACATGGGAGAAGG - Intronic
1157649379 18:49312567-49312589 AAAATGGCTTTCAGCAGAGAGGG - Intronic
1157917324 18:51678630-51678652 GAAGTTGCTGGGAGCGGAGATGG + Intergenic
1157958595 18:52126683-52126705 AAAGTGGCTCTCAGTGGAAGGGG - Intergenic
1158083757 18:53625940-53625962 GAAACAGCTCTCAGCAGAGAAGG - Intergenic
1158912148 18:62075322-62075344 TTAGTGGCTCTCAGGGGTGAGGG - Intronic
1159666112 18:71162234-71162256 AAAGTGGCTCTCAGTGGGAAGGG - Intergenic
1159702026 18:71640874-71640896 AAAGCAGCTCTCAGTGGAGACGG + Intergenic
1159721668 18:71898998-71899020 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1159777500 18:72620371-72620393 AAAGTGGCTCTCAGCAGGAAGGG + Intronic
1160879583 19:1313355-1313377 GTTGAGGCTCTCACCGGAGAGGG + Intergenic
1161668119 19:5589408-5589430 GAAGTGCCTCTCAGCGCGGAGGG + Intronic
1162077359 19:8196689-8196711 GAAGTGTCCCTCAGCTGAGGGGG - Intronic
1162289511 19:9768489-9768511 GAAGAGGCGCTCAGAAGAGAAGG + Exonic
1162844720 19:13383347-13383369 GAAGTTGCTGTCAATGGAGATGG + Intronic
1163674534 19:18648848-18648870 GGAGTGGCTCTGAGCTGGGATGG - Intronic
1164043993 19:21518615-21518637 GAAGTTGCTGTGAGCCGAGATGG - Intronic
1165202166 19:34153924-34153946 GAAGTGGCTCTCAGAGGGATGGG + Intergenic
1165944967 19:39436463-39436485 GAAGGGGCTCTGAGGGGAAAAGG - Intronic
1166247069 19:41536849-41536871 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1166247629 19:41540282-41540304 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1166387476 19:42390300-42390322 TAAGTGGCTCTGGGCTGAGACGG - Intergenic
1166508493 19:43387902-43387924 GAAGTGGCCCTCAGCGTCAAAGG - Intergenic
1166907281 19:46120104-46120126 AAAGTGGCTCTCAGCGGGAAGGG + Exonic
1167268894 19:48497485-48497507 GACACGGCACTCAGCGGAGACGG - Exonic
1168046901 19:53800645-53800667 GAAGTTGCTGTGAGCTGAGATGG - Intronic
1168234100 19:55051162-55051184 GAAGTGGCTCTCAGCTGCACTGG - Intronic
925077001 2:1025210-1025232 GAAGTTGCTCCCAGCTGGGATGG - Intronic
925258051 2:2506760-2506782 GAACTGGCTCCCATCAGAGATGG + Intergenic
925310541 2:2878553-2878575 GAAATGGCTCTCAGCAAAGAGGG + Intergenic
925508993 2:4603528-4603550 GAAGAGGTTCTCAGTGGGGAAGG - Intergenic
925839815 2:7980524-7980546 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
925930461 2:8703209-8703231 GCGGTGGCTGTCAGCGGGGATGG - Intergenic
926052072 2:9751754-9751776 GCAGTGGTTCTCAGCCCAGAGGG + Intergenic
926281494 2:11451413-11451435 GAGGTTGCTGTGAGCGGAGATGG - Intronic
926468896 2:13228005-13228027 GAAGTGGCTGTCAGTGGAAGGGG + Intergenic
926528522 2:14012145-14012167 GAAATGGCTCTCAGCCGAAGGGG - Intergenic
926543017 2:14204609-14204631 GAAGTGGCTCTTAGTGGGAAGGG - Intergenic
926562711 2:14435116-14435138 GAAGTGGCTTTCAGCGGAGAGGG + Intergenic
926825507 2:16901818-16901840 GAAGTAGCTCTCAGCCGATGGGG - Intergenic
926866397 2:17363703-17363725 GATGTGGCCCTCAGCAGACACGG + Intergenic
926889875 2:17629831-17629853 GAAACAGCTCTCAGCTGAGAGGG + Intronic
927072944 2:19548744-19548766 TCTGTGGCTCTCAGAGGAGAGGG - Intergenic
927584018 2:24282390-24282412 GAAGTAGCTCTCAGCAGATGGGG - Intronic
928216613 2:29366636-29366658 GGAGTGAGTCTCAGTGGAGAAGG + Intronic
928494023 2:31813438-31813460 GAAGTGGCTCTCAGCAGGATGGG + Intergenic
928676194 2:33654242-33654264 GAAACAGCTCTCAGCGGAGAGGG - Intergenic
928996975 2:37303218-37303240 GAAATGGCTCTCAGCAGAGTGGG - Intronic
929628520 2:43434701-43434723 GAAGTAGCTCTCAGCAGATGGGG - Intronic
929668160 2:43849832-43849854 GCAGAGGCTCTCAGGGTAGAAGG - Intronic
929886029 2:45879318-45879340 GAAGTGGCTCTCAGCAGGAAGGG - Intronic
930297939 2:49578869-49578891 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
930320101 2:49843711-49843733 GAAGTGGCTGTCAGTGGAAGGGG + Intergenic
930749279 2:54917427-54917449 GAAGTTGCGGTCAGCCGAGATGG - Intronic
931284441 2:60820371-60820393 GAGGTGGCTCTCAGCGGGGATGG + Intergenic
931401195 2:61933046-61933068 GAAGTGGCTCTCAGTGGGATGGG + Intronic
931408372 2:62003166-62003188 GAGGTTGCTGTCAGCCGAGATGG + Intronic
931462951 2:62464013-62464035 AAAGTGGCTCTCAGCGGGAAGGG - Intergenic
931470160 2:62531634-62531656 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
932427135 2:71645267-71645289 GAAGTAGCTCTCAGCAGATTGGG + Intronic
932576542 2:72965334-72965356 GAAGTAGCTCTCAGCAGATAGGG - Intronic
932821951 2:74909111-74909133 TGGGTGGCTCTCAGCGGAAAGGG - Intergenic
932823283 2:74919614-74919636 GAAGTTGCAGTGAGCGGAGATGG - Intergenic
932827263 2:74953007-74953029 GAAGTGGCTGTCAGCAGAATGGG + Intergenic
933026878 2:77271097-77271119 AAAATGGCTGTCAGCGGAGAGGG - Intronic
933178873 2:79207671-79207693 GAAGTGGCTCCCTGCAGAGCTGG + Intronic
933250626 2:80024946-80024968 GAAGTGGGTCTCAGAGGGAAGGG + Intronic
933258579 2:80107516-80107538 GAAATGGCTATCAGCAGAGAGGG - Intronic
933298222 2:80514588-80514610 GAAAAGGCTCTCAGAAGAGAGGG + Intronic
933398836 2:81765671-81765693 GAAGTAGCTCTCAGCTGATGGGG - Intergenic
933442746 2:82334235-82334257 AAAGTGGCTCTCAGTGGGAAGGG + Intergenic
933462909 2:82612167-82612189 GAAGTGGCTCTCAGCAGGATAGG - Intergenic
933674681 2:85044282-85044304 GAAATGGCTCTCTCTGGAGAAGG - Intronic
933770913 2:85743426-85743448 AAAGTGGCCCTCAGCGGTGGTGG - Intergenic
933882205 2:86680982-86681004 GAAGTGGCTCTCAGTGGGAAAGG + Intronic
934028415 2:88019347-88019369 GAAACAGCTCTCAGCTGAGAGGG + Intergenic
934969367 2:98750607-98750629 GAAGTGGCTCTCAGCGGGATAGG - Intergenic
935175909 2:100648542-100648564 AAAGTGGCTCTCAGCAGGAAGGG - Intergenic
935297804 2:101665795-101665817 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
935350315 2:102146924-102146946 GCAGTGGTTCTCAGTGGAGTGGG - Intronic
935830921 2:106999989-107000011 GAAATGGCTGTCAGTGGAAAGGG - Intergenic
935882217 2:107575951-107575973 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
936657627 2:114506355-114506377 AAAGTGGCTCTCAGCAGGAAGGG - Intronic
936846565 2:116842038-116842060 AAAATGCCTCTCAGCAGAGAGGG - Intergenic
936858410 2:116987446-116987468 GAAATGGCTCTCAGTGGAGACGG - Intergenic
937538723 2:122923397-122923419 GAAGTGGCTCTCAGCGGGATCGG + Intergenic
937539039 2:122925790-122925812 GAAGTGGCTCTCAGTGGGATGGG + Intergenic
938030243 2:127986027-127986049 GAAGTAGCTCTCAGCAGATGGGG - Intronic
938942465 2:136181109-136181131 AAAGTGGCTCTCAGTGGAAAGGG + Intergenic
939015022 2:136892524-136892546 GGAGTGGGTCTCGGTGGAGATGG + Intronic
939060793 2:137419455-137419477 GAAATAGCTCTCTGCAGAGATGG + Intronic
939460114 2:142488313-142488335 GAAGTGGCTCTCAGTGAGAAGGG - Intergenic
939490012 2:142866045-142866067 GTAGAGGCTGTCAGCAGAGAAGG + Intergenic
939583980 2:143984845-143984867 GAAGTGGCTCTCAGTGGGAAGGG - Intronic
939700670 2:145386861-145386883 GAAGTGGCTCTCAGCAGGATGGG - Intergenic
939798566 2:146678865-146678887 AAAGTGGCTCTCAGCAGGAAGGG + Intergenic
939928388 2:148201708-148201730 GAAACAGCTCTCAGTGGAGAGGG + Intronic
940599897 2:155845481-155845503 GAAGTAGCTCTCAGCAGAGAGGG - Intergenic
940622896 2:156135115-156135137 CAAGTGGCTCCCAGGAGAGAAGG - Intergenic
941974402 2:171387016-171387038 GAAGTAGCTCTCAGCAGATTGGG - Intronic
942105511 2:172629544-172629566 GCAGTGGCTCTCAGCGGGATAGG - Intergenic
942934145 2:181533623-181533645 GCAGTGGTTCTCAGCAGGGAGGG - Intronic
943384499 2:187184726-187184748 AAAGTGGCTCTCAGTGGGAAGGG + Intergenic
943834387 2:192500586-192500608 AAAGTGGCTCTCAGTGGGAAGGG - Intergenic
944024140 2:195143371-195143393 GATGTGGCTCTCAGTGGAATGGG + Intergenic
944199489 2:197090913-197090935 AAAGTGGCTCTCAGCAGGAAGGG - Intronic
944454420 2:199878534-199878556 TAAGTGGCTCTCAGTGGGAAAGG + Intergenic
944728351 2:202495267-202495289 GAAGTAGCTCTCAGCAGATGGGG + Intronic
944945432 2:204678490-204678512 GAGGTGGCTGTCAGTGGAAAAGG + Intronic
945042298 2:205752409-205752431 AACCTGGCTCTCAGAGGAGATGG - Intronic
945047973 2:205798674-205798696 GAAGTGGCTCTCAATGGAATGGG + Intergenic
945236902 2:207639552-207639574 GAAGTTGCTGTGAGCCGAGATGG - Intergenic
945868604 2:215203243-215203265 TAAGTGGCTCTCAGCTGGAAAGG + Intergenic
946243500 2:218371579-218371601 GAAGTTGCAGTGAGCGGAGATGG - Intergenic
946609403 2:221441458-221441480 GAGGTGGCTCTCAGCGGGATGGG - Intronic
947227294 2:227852765-227852787 GAAATGGGTCTCAGCAGAGAGGG + Intergenic
948504074 2:238416069-238416091 GAAACAGCTCTCAGCAGAGATGG + Intergenic
949030706 2:241795868-241795890 GAAGAGGCTCCCAGCGGCCAAGG - Intronic
1169440134 20:5626945-5626967 AAAGTGGCTCTCAGCAGGAAGGG - Intergenic
1170243552 20:14195807-14195829 GAAGTAGCTCTCAGCAGATGGGG - Intronic
1171384207 20:24756744-24756766 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1172634588 20:36401387-36401409 GAGGGGGCTCTGAGCTGAGAGGG + Intronic
1172737782 20:37141057-37141079 GTAGTCGTTCTCAGCTGAGAAGG + Intronic
1174126654 20:48311574-48311596 GAAGTCGCTCTCAGCCGATGGGG + Intergenic
1175643424 20:60650731-60650753 GAAGTGCATCTCATCGAAGAAGG + Intergenic
1176149867 20:63584988-63585010 GAAGTTGCAGTGAGCGGAGATGG + Intergenic
1176520146 21:7818236-7818258 GGAGTGGCTCTGGGCAGAGAGGG - Exonic
1176695506 21:9972453-9972475 AAAGTGGCTCTCAGCAGGAAGGG + Intergenic
1177339530 21:19782167-19782189 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1177639901 21:23833218-23833240 GAAGTAGCTCTCTGCCGATAAGG + Intergenic
1177644808 21:23887452-23887474 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1177773126 21:25539292-25539314 GAAACAGCTCTCAGTGGAGAGGG - Intergenic
1177962087 21:27679941-27679963 GAAATGTCTCTCAGCAGAGATGG + Intergenic
1177967352 21:27744520-27744542 AAAATGGCTCTCAGTGGAGAGGG + Intergenic
1178103806 21:29298025-29298047 GCACTGGCTGTCAGCGGAGCGGG - Intronic
1178624528 21:34203977-34203999 GCAGTGGGTCTGAGGGGAGACGG + Intergenic
1178654172 21:34448248-34448270 GGAGTGGCTCTGGGCAGAGAGGG - Intergenic
1180602582 22:17032286-17032308 GAGGTGGCTCTCAGCATAGGAGG + Intergenic
1180839601 22:18953121-18953143 GAGGTGGCTCCCAGCAGATAGGG + Intergenic
1180937027 22:19632652-19632674 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1180969823 22:19809375-19809397 GAAGTAGCTCTCAGCAGATGAGG - Intronic
1181040612 22:20190817-20190839 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1181043995 22:20206049-20206071 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1181062303 22:20287358-20287380 GAGGTGGCTCCCAGCAGATAGGG - Intergenic
1181175097 22:21030817-21030839 GAAGAGTCTCTCACCGCAGATGG + Exonic
1182460311 22:30478888-30478910 GAAGTGGCTCTCAGCAGGATGGG - Intergenic
1183890119 22:40920396-40920418 GAGGAGGCTTTCAGGGGAGATGG + Intronic
1183944006 22:41313805-41313827 GAAGTTGCTGTGAGCCGAGATGG - Intronic
1184335358 22:43849639-43849661 AAAGTGGCTCTCAGCGGGAAGGG - Intronic
1184578754 22:45397831-45397853 GAAACAGCTCTCAGCAGAGAGGG - Intronic
949227403 3:1711156-1711178 AAAGTGGCTCTCAGCAGAGAGGG + Intergenic
949675432 3:6447902-6447924 AAAGTGGCTCTCAGCAGAGAGGG + Intergenic
950780926 3:15390961-15390983 AAAGTGGCTCTCAGCGGGATGGG + Intronic
950978924 3:17280663-17280685 AAAGTGGCTCTCAGTGGGAAGGG - Intronic
950979612 3:17288697-17288719 GAAATAGCTCTCACTGGAGAGGG - Intronic
950997473 3:17518529-17518551 AAAGTGGCTCTCAGTGGGAAGGG - Intronic
951004359 3:17599473-17599495 GAGGTGGCTCTCAGTGGAATGGG - Intronic
951134136 3:19083779-19083801 GAAGTGGCTCTCAGAGGGATGGG - Intergenic
951501336 3:23390451-23390473 GAAGTGGCTCTCAGCAAAAGGGG - Intronic
951534653 3:23729713-23729735 GAAGTGGCTCTCTGCGGTAGAGG - Intergenic
951651374 3:24955156-24955178 GAAGTGGCTCTCAGCAGAAGGGG + Intergenic
951651824 3:24959323-24959345 GAAGTGGCTCTCAGTGGGAAGGG + Intergenic
951692460 3:25410861-25410883 CAAGTGGCTCTCTGCAGAGCAGG - Intronic
952109780 3:30109136-30109158 GAAGTGGCTCTCAGTGGGATGGG - Intergenic
952181458 3:30920745-30920767 AAAGTGGCTCTCAGTGGGAAGGG - Intergenic
952561772 3:34603648-34603670 GAAGTGGCTCTCAGCAGGAAGGG - Intergenic
953088392 3:39697487-39697509 GAAGTAGCTCTCAGCCGATGGGG - Intergenic
954145918 3:48634220-48634242 GGACTGGCTCTCACCTGAGAAGG + Intronic
956301272 3:67775156-67775178 GAAATGGCTCTTAGTGGAGAGGG + Intergenic
956778621 3:72587177-72587199 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
956797770 3:72731949-72731971 GAAGTGGCTTCCAGGGAAGAAGG - Intergenic
956968438 3:74491433-74491455 GAAGTTGCTGCCAGCTGAGATGG + Intronic
957058047 3:75459295-75459317 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
957210102 3:77248212-77248234 AAAGTGGCTCTCAGCAGAAAGGG - Intronic
957292476 3:78295125-78295147 GAAGTAGCTCTCAGCAGAAGGGG - Intergenic
957414138 3:79878681-79878703 GAGGTGGCTCTCAGTGGGAAGGG + Intergenic
957430477 3:80099081-80099103 GAGGTGGCAGTGAGCGGAGATGG - Intergenic
957586525 3:82139396-82139418 GAAGTGGCTGTCAGCAGATGGGG + Intergenic
957924605 3:86792234-86792256 GAAGTGGTACTGAGCCGAGATGG + Intergenic
958100226 3:88999378-88999400 AAAGTGGCTCTCAGCTGGAAGGG - Intergenic
958119283 3:89263501-89263523 AAAGTGGCTCTCAGCAGTAACGG + Intronic
959265089 3:104127100-104127122 GAAACAGCTCTCAGTGGAGAGGG + Intergenic
959583441 3:108004474-108004496 GAAGTAGCTCTCAGCAGATGCGG - Intergenic
959694190 3:109231891-109231913 GAAGTGGCTCTCAGCAGGATGGG - Intergenic
959813901 3:110652784-110652806 GAAGTGGCTCTCAGCAGGATGGG - Intergenic
959946854 3:112134174-112134196 GAAGTGGCTCTCAGTGGAAGGGG - Intergenic
960023945 3:112987798-112987820 GAAGTAGCTCACAGCAGATAGGG + Intergenic
960415801 3:117383421-117383443 GAAGTAGCTCTCAGCAGATGAGG - Intergenic
961002221 3:123381726-123381748 GCAGTGGCTCTCAGGAGCGATGG - Intronic
961295406 3:125880420-125880442 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
961443494 3:126966894-126966916 GAAGTGGCTCTCAGCAGCCAAGG - Intergenic
961580357 3:127875776-127875798 CATGTGGCTCTCTGGGGAGAGGG - Intergenic
961598915 3:128043498-128043520 GAAACAGCTCTCAGCAGAGAAGG + Intergenic
961671364 3:128533925-128533947 GAAGTGGCTAACAGTGAAGATGG + Intergenic
962119616 3:132548091-132548113 GAAATGGCTCTCAGCAGAGAGGG - Intergenic
962269412 3:133967100-133967122 GAAGCGACTCTCAGCGGAGCAGG + Intronic
962474361 3:135742380-135742402 GAAATGGCTCTCAGCAGAGAGGG - Intergenic
962595033 3:136933767-136933789 GAAGTGGCAGTGAGCTGAGATGG - Intronic
962627267 3:137238404-137238426 GCAGTGGTTCTCAGTGGAGATGG + Intergenic
962674974 3:137749141-137749163 GTACTGGCTCTCAGCAGGGAGGG + Intergenic
963100770 3:141601368-141601390 GAAGTTGCTGTGAGCCGAGATGG + Intronic
963378826 3:144503827-144503849 CAAATGGCTCTCAGCAGAGAGGG + Intergenic
963410565 3:144922061-144922083 AAAGTGGCTCTCAGTGGGAAGGG + Intergenic
963655903 3:148049728-148049750 GAAGTGGCTCTCAGAGGATGGGG - Intergenic
964920540 3:161890752-161890774 AAAGTGGCTCTCAGCAGAGAGGG + Intergenic
964952298 3:162311040-162311062 GAAGTTGCTGTGAGCAGAGATGG - Intergenic
964987831 3:162766309-162766331 GAAATAGCTCTCAGCAGAGAGGG + Intergenic
965039700 3:163490567-163490589 GAAATGGCTCTCAGCAGAGAGGG + Intergenic
965123641 3:164595664-164595686 AAAATGGCTCTCAGCAGAGAGGG + Intergenic
965216294 3:165868567-165868589 AAAATGGCTCTCAGTGGAGAGGG + Intergenic
965890891 3:173512358-173512380 AAAGTGGCTCTCAGTAGAGAGGG + Intronic
966273755 3:178141056-178141078 AAAGTAGCTCTTAGCTGAGATGG + Intergenic
966285770 3:178293748-178293770 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
966958428 3:184908769-184908791 GAAATGGCTTTCTGCAGAGAGGG + Intronic
967127952 3:186442812-186442834 GAATGGGCTCTCAGCAGACATGG - Intergenic
967795348 3:193593262-193593284 GAAGTGGCCCTCAGCAGCAAGGG - Exonic
968295763 3:197575416-197575438 GGAATGGCTATCAGCGGAGAGGG - Intergenic
969532341 4:7736889-7736911 GAAGTGGCTTTGAGCAGAGATGG + Intronic
969702169 4:8773678-8773700 GAGGTGGCTCCCAGGGAAGAGGG + Intergenic
970576956 4:17437182-17437204 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
970898651 4:21132946-21132968 GAAGTTGCAGTCAGCTGAGATGG + Intronic
971427325 4:26529493-26529515 GAAGTGGCTCTCAGCAGAAGGGG + Intergenic
971427486 4:26530581-26530603 AAAGTGGCTCTCAGCAGGAAGGG - Intergenic
971749740 4:30631923-30631945 GAAATGGTTCTCTGTGGAGAGGG - Intergenic
971873687 4:32276366-32276388 GAAGTGGCTCTCAGTGGGATGGG + Intergenic
971959822 4:33471341-33471363 GAAATGGCTCTCAGCAGAGAGGG + Intergenic
971986919 4:33838006-33838028 GCAGTGGCTCTCAGCAGATGGGG - Intergenic
972681672 4:41312271-41312293 GAAGTGGCTCCCAGCGGGATAGG - Intergenic
972917867 4:43903387-43903409 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
972918447 4:43907174-43907196 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
973022448 4:45220390-45220412 GGAATGGTTCTCAGAGGAGACGG + Intergenic
973057442 4:45678794-45678816 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
973141037 4:46768241-46768263 GAAGTGGCTCTCAGCAGGATGGG + Intronic
973970719 4:56211580-56211602 GAAACAGCTCTCAGCGGAGAGGG + Intronic
974012273 4:56617814-56617836 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
974344599 4:60662495-60662517 GAAGTGGCTCTCAGCAGGAAGGG + Intergenic
974456773 4:62138818-62138840 GAAACAGCTCTCAGCAGAGAGGG + Intergenic
974669702 4:65014131-65014153 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
975213811 4:71731148-71731170 GAAGTGGCTCTCAGCGGGATGGG - Intergenic
975707780 4:77128104-77128126 GAAGTGGCTCTCGGTGGAAGGGG + Intergenic
976070631 4:81236063-81236085 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
976473419 4:85455489-85455511 GAAGTGGCTCTCAGTGGGATGGG - Intergenic
976751440 4:88454586-88454608 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
976859076 4:89641010-89641032 GAGGTGGCTCTCAGCGGGAAGGG - Intergenic
977019358 4:91740701-91740723 AAAGTGGCTCTCAGCGAGAATGG - Intergenic
977220477 4:94332217-94332239 GAAATGGCTCTCAGCAGAGAGGG - Intronic
977306299 4:95327790-95327812 GAAGTGGCTCTCAGCAGAAGGGG - Intronic
977338700 4:95730095-95730117 AAAGTGGCTCTCAGCGGGAAGGG + Intergenic
977357851 4:95969341-95969363 GAAGTGGCTCTCAGCAGGAAGGG - Intergenic
977721489 4:100244660-100244682 GAAGTGGCACTCAGTGGGAAGGG + Intergenic
977756953 4:100682800-100682822 GAAGTAGTTCTCAGCAGACAGGG - Intronic
978398850 4:108310433-108310455 GAAGTGGCTCTCAGCAGGATGGG - Intergenic
978579794 4:110220404-110220426 GAGGTGGCCCTCAGCAGACAGGG + Intergenic
978593891 4:110356125-110356147 AAAGTGGCTCTCAGTGGAAAAGG - Intergenic
979088916 4:116453185-116453207 GAAGTAGCTCTCAGCAGATGAGG + Intergenic
979140177 4:117162565-117162587 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
979188119 4:117824325-117824347 AAAGTGGCTCTCAGCGGAGAGGG - Intergenic
979716479 4:123844685-123844707 AAAGTGGCTCTCAGTGGGAAGGG + Intergenic
979727599 4:123982824-123982846 GAGGTGGCTCTCAGCAGGGTGGG + Intergenic
979728409 4:123992265-123992287 GAAGTGGCTCTCAGTGGGATGGG - Intergenic
979919312 4:126478538-126478560 GAAGTGGCTCTCAGTGGGATGGG - Intergenic
980305927 4:131061444-131061466 GAAAAAGCTCTCAGCAGAGAGGG + Intergenic
980368132 4:131832701-131832723 AAAGTGGCTCTCAGCAGGAAGGG + Intergenic
980400950 4:132285031-132285053 GAAAAAGCTCTCAGCAGAGAAGG - Intergenic
980485442 4:133451152-133451174 GAAGTAGCTCTCAGCGGATGGGG - Intergenic
980627487 4:135391915-135391937 GAAATGGCTCTCAGTGGAGAGGG + Intergenic
980680643 4:136155396-136155418 GAAATGGCTCTCAGCTGAGAGGG + Intergenic
980729138 4:136804675-136804697 AAAATGGCTTTCAGCAGAGAGGG - Intergenic
981317207 4:143351279-143351301 GAAGTAGCTCTCAGCAGATGGGG + Intronic
981597662 4:146445723-146445745 GAAGTGGCTTTCAGAGGGAAAGG + Intronic
982315113 4:154024003-154024025 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
982478066 4:155877203-155877225 GAAGTTGCACTGAGCTGAGATGG + Intronic
982671043 4:158320397-158320419 GAAGTGGCTCTGAGTGGGAAGGG + Intronic
982861982 4:160463781-160463803 AAAGTGGCTCTCAGTGGGAAGGG + Intergenic
982869142 4:160553734-160553756 GAAGTGGCTCTCAGTGGGAAGGG + Intergenic
983070087 4:163257383-163257405 GATGTGGCTCTCAGCCGAATGGG + Intergenic
983172526 4:164552094-164552116 AAAGCAGCTCTCAGTGGAGAGGG + Intergenic
983697866 4:170554616-170554638 AAAGTGGCTCTCAGCAGAGAGGG + Intergenic
984064675 4:175033290-175033312 GAAACAGCTCTCAGTGGAGAGGG + Intergenic
984098053 4:175455490-175455512 GAAGTGGCTCTCAGCAGCATGGG + Intergenic
984105549 4:175541157-175541179 AAAGTGGCTCTCAGGGAAGAGGG + Intergenic
984245941 4:177275351-177275373 GAAGTGGCTCTCAGTGGGAAGGG - Intergenic
984263643 4:177471081-177471103 GAAGTAGCTCTCAGCGGATGGGG + Intergenic
984289850 4:177781629-177781651 GAAGTAGCTCTCAGCAGATAGGG + Intronic
984300566 4:177912101-177912123 AAAGTGGCTCTCAGCGGGAAGGG + Intronic
984359622 4:178711644-178711666 AAAGTGGCTCTCATTGGAGAGGG + Intergenic
984417222 4:179477221-179477243 GAAGTGGCTCTCAGTGGGGTGGG - Intergenic
984543815 4:181074455-181074477 GAAGTGGCTCTCAGCAGGAAGGG - Intergenic
985023081 4:185712371-185712393 AAAGTGGCTCTCAGTGGGAAGGG - Intronic
985048902 4:185970342-185970364 GAGGTGGCTCTCAGTGGGAAGGG + Intergenic
985101216 4:186460365-186460387 GGAGCAGCTCTCAGCAGAGAGGG + Intronic
986076190 5:4340421-4340443 GAAATGGCTCTCAGTGGAGAGGG + Intergenic
986164748 5:5263956-5263978 AAAATAGCTCTCAGCAGAGAGGG + Intronic
986178179 5:5369613-5369635 GAAGGGGCTCTCCTGGGAGAAGG + Intergenic
986929891 5:12805126-12805148 AAAGTGGCTCTCAGTGGGAAGGG - Intergenic
987251138 5:16102634-16102656 GAAGTGGCTCTCAGTGGGATGGG - Intronic
987433336 5:17863334-17863356 GTTGAGGCTCTCAGTGGAGAAGG - Intergenic
988267235 5:28967727-28967749 GAAGTAGCTCTCAGCAGATTGGG - Intergenic
989161279 5:38393955-38393977 TGGGTGGCTCTCAGCGGAAAGGG + Intronic
990463156 5:56047983-56048005 GAAGTGGCTCTCAGTGGGATAGG - Intergenic
990463788 5:56053416-56053438 GAAGTGGCTCTCAGTGAGAAAGG - Intergenic
990560622 5:56980036-56980058 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
990683864 5:58278016-58278038 AAAGTGGCTCTCAGCAGAGAGGG - Intergenic
990698232 5:58446556-58446578 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
991115258 5:62947041-62947063 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
991207456 5:64065910-64065932 GAAGTGGCTCTCAGCAGGATGGG - Intergenic
991425720 5:66489719-66489741 GAAGTGGCTTTCAGTGGATGGGG + Intergenic
991645345 5:68795552-68795574 AAAGCAGCTCTCAGCAGAGAGGG + Intergenic
992038186 5:72802483-72802505 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
992205930 5:74430272-74430294 GAAGTGGCTCTCAGTAGAGAGGG - Intergenic
992231680 5:74670365-74670387 AAAATAGCTCTCAGCAGAGAGGG - Intronic
992643246 5:78788162-78788184 GAGGTGGCTTTCAGCTCAGAAGG - Intronic
993036253 5:82760807-82760829 AAAGTGGCTCTCAGCAGGAAGGG - Intergenic
993274863 5:85844037-85844059 AAAGTGGCTCTCAGCAGGAAGGG + Intergenic
994188067 5:96837824-96837846 AAAGTGGCTCTCAGCGTGAAGGG + Intronic
994301913 5:98157458-98157480 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
994433222 5:99695348-99695370 GAAGTGACTCTCAGTGGAAGGGG + Intergenic
994627034 5:102232806-102232828 AAAGTGGCTCTCAGCCGCAAGGG + Intergenic
994775271 5:104031326-104031348 GAAGTGGCTCTCGGTGGGAAGGG - Intergenic
994871197 5:105351852-105351874 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
995159890 5:108967277-108967299 AAAACGGCTCTCAGCAGAGAGGG + Intronic
995284259 5:110368764-110368786 AAAGTGGCTCTCAGTGGAAGGGG + Intronic
995320724 5:110830703-110830725 GAAACAGCTCTCAGCAGAGAGGG - Intergenic
995420630 5:111962884-111962906 GAAGTGGCTGTCAGTGGAGAGGG - Intronic
995533650 5:113114805-113114827 AAAGTGGCTCTCAGCAGGAAGGG - Intronic
995740865 5:115354540-115354562 GAAGTGGCTCTCATTGGGTAGGG + Intergenic
996706280 5:126501880-126501902 GAAGTGGCTCTCAGCTGGAAAGG + Intergenic
997318141 5:132955029-132955051 GAAGTGGCTCTCAGCAGGATGGG + Intronic
997421082 5:133767262-133767284 AGAGTGGCTCTCAGGGGTGAGGG + Intergenic
997440310 5:133904624-133904646 GAAGTTGCAGTGAGCGGAGATGG + Intergenic
997647211 5:135489433-135489455 GAAGTGGCTCCCAGGGGAACAGG - Intergenic
997780401 5:136652259-136652281 AAAATGGCTTTCAGTGGAGAGGG + Intergenic
998674341 5:144390359-144390381 GAATTGGATCTCAGAAGAGAGGG + Intronic
998791168 5:145767341-145767363 GAAGTGGCTCTCAGCGGGATGGG - Intronic
1000541884 5:162550564-162550586 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1000600831 5:163272974-163272996 AAAATGGCTTTCAGCAGAGAGGG + Intergenic
1000852876 5:166362107-166362129 GAGGTGGCTCTCAGCAGGGTGGG + Intergenic
1001181155 5:169521904-169521926 GAAGTAGCTCTCAGCAAATAGGG - Intergenic
1001973734 5:175979347-175979369 AAAACAGCTCTCAGCGGAGAGGG - Intronic
1002243698 5:177864432-177864454 AAAACAGCTCTCAGCGGAGAGGG + Intergenic
1002321917 5:178381387-178381409 GAAGTGCCACTCAGAGCAGAAGG + Intronic
1002434994 5:179225759-179225781 GAAGTAGCTCTCAGCAGATGGGG - Intronic
1002843357 6:924564-924586 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1002961835 6:1922803-1922825 GAAATGGCTCTCAGCAGAGACGG - Intronic
1002962232 6:1926102-1926124 GAAGTAGCTCTCAGCAGATGGGG - Intronic
1002999745 6:2319808-2319830 AAAGTGGCTCTCAGAGGAGAGGG + Intergenic
1003121264 6:3320598-3320620 GAAGTGGCCCGCTGTGGAGAGGG - Intronic
1003194009 6:3898993-3899015 GATGTGGCTCTCAGCAGAATGGG + Intergenic
1003791670 6:9553253-9553275 GGAATAGCTCTCAGTGGAGAGGG + Intergenic
1004138385 6:12990788-12990810 GAAGTGGCTCTCAGAGAATCAGG + Intronic
1004390451 6:15205275-15205297 GAGGTTGCACTCAGCCGAGATGG - Intergenic
1004647200 6:17573895-17573917 GAAGTGGCTCTCAGCTGGATGGG + Intergenic
1004906118 6:20238784-20238806 GAAGTGACTCTCAGCGAGAAGGG + Intergenic
1005227032 6:23655166-23655188 GAAGCGGCTCTTAGGAGAGAGGG - Intergenic
1006208935 6:32376063-32376085 GAAGTGGCTCTCAGCAGATGGGG - Intergenic
1006391718 6:33762481-33762503 GAAGTGTCTCTCACTGGAGCAGG - Intergenic
1006409584 6:33864804-33864826 GAATCAGCTCTCAGCGGAGAGGG - Intergenic
1007307580 6:40918927-40918949 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1007854905 6:44845800-44845822 GAAGTAGCTCTCAGCAGATAGGG - Intronic
1008248092 6:49203781-49203803 AAAATGGCTGTCAGCAGAGAGGG - Intergenic
1010294725 6:74182729-74182751 GAAATGACTCTCAGCAGAGAGGG - Intergenic
1010494216 6:76513800-76513822 GAGGTGGCTCTCAGGGGAATGGG + Intergenic
1010556154 6:77281940-77281962 GAAATGGCTCTCAGTGGAGAGGG + Intergenic
1010732366 6:79404600-79404622 AAAGTGGCTCTCAGCAGAGAGGG - Intergenic
1011294446 6:85811028-85811050 AAAGTGGCTCTCAGCAGGAAGGG + Intergenic
1011493524 6:87916531-87916553 AAAGTGGCTCTCAGCAGGAAGGG - Intergenic
1011639598 6:89406605-89406627 GAAGTAGCTCTCAGCAGATAGGG - Intronic
1011873504 6:91926859-91926881 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1012440203 6:99255198-99255220 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1013113019 6:107079275-107079297 GAAGTAGCTCTCAGCAGATGGGG - Intronic
1013216543 6:108032618-108032640 GAAATGGCTCTTAGCCTAGAGGG + Intergenic
1013492340 6:110660583-110660605 AAAGTGGCTCTCAGCAGGAAGGG + Intronic
1014107409 6:117582680-117582702 AAAGTGGCTCTCAGCAGAGAGGG - Intronic
1014252204 6:119126830-119126852 GAAGTGGCTCTCAGCAGGAAGGG + Intronic
1014276315 6:119394238-119394260 AAAGTGGCTCTCAGCAGGAAAGG + Intergenic
1014323807 6:119966402-119966424 GAAGTGCCTCTCAGCAGATGAGG - Intergenic
1014447634 6:121547062-121547084 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1014492754 6:122082450-122082472 GAAGTAGCTCTCTGCTGAGGGGG + Intergenic
1014740505 6:125143433-125143455 AAAGGGGCTCTCAGTGGAGAGGG + Intronic
1014817493 6:125951989-125952011 GAAGTTTCCCTCAGCTGAGATGG + Intergenic
1015729619 6:136334763-136334785 GAAGTAGCTCTCAGCAGATTGGG - Intergenic
1015790416 6:136959387-136959409 AAAGTGGCTCTCAGAGGAAATGG - Intergenic
1016082990 6:139878373-139878395 GGAATGGCTCTCAGTAGAGAGGG + Intergenic
1016205771 6:141466736-141466758 AAAATGGCTCTCAGTGGAGAGGG + Intergenic
1016206481 6:141473466-141473488 AAAATGGCTCTCAGTGGAGAGGG + Intergenic
1016730484 6:147422757-147422779 GAAACAGCTCTCAGCGGAGAGGG - Intergenic
1018064468 6:160115771-160115793 GAAGTGGCTGTCAGCACACAGGG - Intergenic
1018654770 6:166024750-166024772 GAAATGGCTCTCAGCAGAGAGGG + Intergenic
1018831082 6:167444098-167444120 GAAGTGGCTCTCAGCAGAAGGGG + Intergenic
1019148772 6:169990720-169990742 GAGGCGGCTCTGAGTGGAGAGGG - Intergenic
1019527362 7:1486785-1486807 GAAGGGGCTCTCAGGGGTGCAGG + Intronic
1020564558 7:9778862-9778884 GGACTGGCTCTCAGCGAAGAGGG + Intergenic
1020739070 7:11990369-11990391 AAAGTGGCTCTCAGTGGAAAGGG + Intergenic
1021823967 7:24529337-24529359 GAAGTTGCAGTTAGCGGAGATGG - Intergenic
1022438672 7:30413955-30413977 GAAACAGCTTTCAGCGGAGAGGG - Intergenic
1022464430 7:30643715-30643737 GAAGGGGCTCTTAGCCAAGAGGG - Intergenic
1022679624 7:32532091-32532113 AAAGTGGCTCTCAGTGGAAAGGG + Intronic
1022721822 7:32948430-32948452 GGAATAGCTCTCAGCGGAGAGGG - Intergenic
1022877047 7:34544868-34544890 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1023500489 7:40844380-40844402 GAAGTGGCTCTCAGTGGGAAGGG + Intronic
1024264548 7:47596755-47596777 GAAGTAGCTCTCAGCAGACGAGG - Intergenic
1024265126 7:47600496-47600518 GAAGTAGCTCTCAGCAGACAGGG - Intergenic
1025562727 7:62389495-62389517 GAAGTTGCAGTGAGCGGAGATGG + Intergenic
1026674856 7:72419908-72419930 GAAGTGGCTCTTGGTGGAGAGGG - Intronic
1026918710 7:74139436-74139458 AAAGCGACTCTCAGTGGAGAGGG - Intergenic
1026919563 7:74145135-74145157 AAAGTGGCTCTAAGCGGGAAGGG - Intergenic
1027616807 7:80433892-80433914 AAGATGGCTCTCAGAGGAGAGGG - Intronic
1027932287 7:84552797-84552819 GAAGTAGCTCTCAGCAGATCCGG - Intergenic
1028000709 7:85494613-85494635 GAAATGGCTTTCAGAGAAGAGGG + Intergenic
1028020782 7:85768451-85768473 GAAACAGCTCTCAGCGGAGAGGG - Intergenic
1028943291 7:96549322-96549344 GCAGGGGCTCTCAGCAGACATGG - Intronic
1029033220 7:97490615-97490637 GAAGTAGCTCTCAGCAGATGCGG - Intergenic
1029239461 7:99148958-99148980 GAAGTTGCTGTGAGCCGAGACGG - Intergenic
1030385454 7:108863141-108863163 GAAATAGCTCTCAGCAGAAAGGG - Intergenic
1030386149 7:108870559-108870581 AAAGTGGCTCTCAGTGGGGAGGG + Intergenic
1030787862 7:113684687-113684709 AAAATGGCTCTCAGTGGAGAGGG + Intergenic
1030794410 7:113770274-113770296 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1031063416 7:117077004-117077026 AAAGTGGCTCTCAGTGGAAAGGG + Intronic
1032157235 7:129478443-129478465 GAAGTTGCTGTGAGCCGAGATGG + Intronic
1032196151 7:129789790-129789812 GAGGGGGCTCTGAGTGGAGAAGG - Intergenic
1032219578 7:129983769-129983791 GAGGTTGCTGTCAGCTGAGACGG + Intergenic
1032612471 7:133430126-133430148 GAAGTGGCTGTCAGCGGGATGGG + Intronic
1033071755 7:138209446-138209468 AAAGTGGCTCTTAGTGGAAAGGG + Intergenic
1033418498 7:141185358-141185380 GAAGTAGCTCTCAGCAGATGAGG + Intronic
1033928199 7:146489760-146489782 GGAATAGCTCTCAGCAGAGAAGG + Intronic
1034092987 7:148381400-148381422 AAAGTGGCTCTCAGCAGGAAGGG + Intronic
1034504066 7:151472066-151472088 GAGGTGGCTCTCACCGGGAAGGG + Intronic
1035184011 7:157111780-157111802 AAAGTGGCTCTCAGTGGTAAGGG + Intergenic
1035199146 7:157248930-157248952 GAGGTGGCTCTGAGCGGGCAAGG - Intronic
1035339856 7:158153217-158153239 GAAGTAGCTCTCAGCAGATGGGG - Intronic
1035824391 8:2629065-2629087 GAAGTGGCTCTCAGCAGGATGGG + Intergenic
1037056275 8:14445557-14445579 GAAATGGTTTTCAGTGGAGAGGG - Intronic
1037331544 8:17748317-17748339 AAAGTGGCTCTCAGCAGAGAGGG - Intronic
1037363424 8:18097592-18097614 AAAGTGGCTCTCAGCAGGAAGGG - Intergenic
1037427393 8:18770939-18770961 GAAGTGGCTCTCAGCAGGAAGGG + Intronic
1037533431 8:19802299-19802321 AAAGTGGCTCTCAGTAGAGAAGG - Intergenic
1037689567 8:21170754-21170776 GAAGAGGCTATGAGCGGTGATGG + Intergenic
1037971576 8:23175417-23175439 GAGGTGGCTCTTGGAGGAGAGGG + Intergenic
1038402336 8:27294148-27294170 GAAGCAGCTCACAGAGGAGACGG - Exonic
1038862385 8:31401643-31401665 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1038931871 8:32202636-32202658 GAGGTGGCTCTCAGCAGGAAGGG + Intronic
1039039708 8:33395527-33395549 GAAGTGGCTCTCAGTGGGATGGG - Intronic
1039076239 8:33692999-33693021 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1039076390 8:33693836-33693858 GAAGTGGCTCTTAATGGAGAGGG - Intergenic
1039086309 8:33783586-33783608 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1039162600 8:34639402-34639424 ACAGTGGCTCTCAGCGGGAAGGG - Intergenic
1039645508 8:39278062-39278084 AAAGTGGCTTTCAGCGGGAAGGG + Intronic
1039661371 8:39470851-39470873 AAAGTGGCTCTCAGTGGAAAGGG - Intergenic
1039679077 8:39709178-39709200 AAAGTGGCTCTCAGTGGGAAGGG + Intronic
1039865676 8:41499468-41499490 GAAGTAGCTCTCAGCAGATGGGG + Intronic
1040008816 8:42643802-42643824 GAAGTGTCTTTCAGAAGAGATGG + Intergenic
1041131955 8:54710646-54710668 AAAGTCGCTGTCAGCGGAGAGGG + Intergenic
1041312357 8:56529780-56529802 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1041775231 8:61515590-61515612 GACCTGGCACTCAGGGGAGAAGG - Intronic
1041918297 8:63157846-63157868 GAAGTGGCTCTCAGTGGGATGGG + Intergenic
1041934723 8:63322458-63322480 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1042231183 8:66556387-66556409 GAGGTAGCTCTCAGCTGAGGTGG - Intergenic
1042238702 8:66640798-66640820 GAGGTGGCTCTCAGTGGGGTGGG - Intronic
1042598202 8:70471767-70471789 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1042819715 8:72916721-72916743 AAAGTGGCTCTCAGCAGGAAGGG + Intronic
1043220460 8:77655832-77655854 GAAGTGGCTCTCAGCAGGTTGGG - Intergenic
1043310967 8:78859270-78859292 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1043438959 8:80260207-80260229 GAAATGGCTTTCAGTGAAGAGGG + Intergenic
1043605281 8:81991705-81991727 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1043951283 8:86311709-86311731 AAAGTGGCTCTCAGTGGACAGGG - Intronic
1044085336 8:87936410-87936432 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1044325433 8:90852784-90852806 AAAGTGGCTCTCAGTGGGAAGGG - Intronic
1044631021 8:94278690-94278712 AAAACGGCTCTCAGCAGAGAGGG + Intergenic
1045118749 8:99013008-99013030 GAAGTGGCGCTCCGGGGAGAAGG - Intergenic
1045762646 8:105628732-105628754 AAAGTGGCTCTCAGTGGGAAGGG - Intronic
1045821835 8:106347359-106347381 GTAGTGGTTATCACCGGAGAAGG + Intronic
1045938495 8:107710964-107710986 GAAGTTGCTCTCAGCAGATGGGG + Intergenic
1046142712 8:110115912-110115934 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1046229510 8:111335119-111335141 GAAGTAGCTCTCAGCAGATGCGG + Intergenic
1046250458 8:111624216-111624238 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1046648496 8:116811331-116811353 GAAGTTGCACTGAGCAGAGATGG - Intronic
1047363642 8:124192631-124192653 GAAGTGGCTGACAGAGGAGGAGG - Intergenic
1047542611 8:125785048-125785070 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1047878831 8:129170262-129170284 AAAGTGGCTTTCAGCGGGAAGGG - Intergenic
1048485944 8:134847732-134847754 GAAACAGCTCTCAGCGGAGAGGG - Intergenic
1048616077 8:136076869-136076891 AAAGCGGATCTCAGTGGAGAGGG + Intergenic
1048641690 8:136370227-136370249 GAAATGGCTCTCAGCAGAGAGGG + Intergenic
1048648691 8:136450926-136450948 GAGGTGGCTCTCAGGGTGGATGG + Intergenic
1048712407 8:137226960-137226982 GAAACAGCTCTCAGCAGAGATGG + Intergenic
1048800414 8:138189286-138189308 AAAGTGGCTCTCAGTGGGAAGGG - Intronic
1049681490 8:143920520-143920542 GAAGCTGCTATCAGCCGAGAAGG - Exonic
1049936508 9:505201-505223 GAAGCGGCTCTCCGTGGAGTTGG + Intronic
1049978855 9:885390-885412 GAAGTAGCTCTCAGCAGATAGGG + Intronic
1050043624 9:1521120-1521142 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1050784840 9:9388092-9388114 GAAGTAGCTCTCAGCAGATGGGG + Intronic
1050931335 9:11330848-11330870 GAAACAGCTCTCAGCAGAGAAGG + Intergenic
1050939711 9:11443350-11443372 AAAATGGCTGTCAGCAGAGAGGG - Intergenic
1051886998 9:21904015-21904037 GAAGTAGCTCTCAGCAGATGGGG + Intronic
1051986121 9:23089449-23089471 GAAACCGCTCTCAGCAGAGAGGG + Intergenic
1051996124 9:23219934-23219956 AAAATGGCTCTCAGTGGAGAGGG + Intergenic
1052122130 9:24730841-24730863 GAAATGGCTCTCAGTGGAGCAGG + Intergenic
1052289300 9:26823913-26823935 GAAGTGGCTCTCAGTGAGGTGGG + Intergenic
1052465894 9:28829260-28829282 TAAGTGGCTCTCAGCGGGAAGGG - Intergenic
1052660174 9:31419344-31419366 AAAGTGGCTCTCAGCAGATAGGG - Intergenic
1052909528 9:33868063-33868085 TGGGTGGCTCTCAGCGGAAAGGG + Intronic
1053063876 9:35052818-35052840 GAAGTTGCACTGAGCTGAGATGG + Intergenic
1053208027 9:36204560-36204582 GAAGTGGCTTTCAGGGGGCAGGG - Intronic
1053600091 9:39601957-39601979 GAAACAGCTCTCAGAGGAGAGGG - Intergenic
1053632488 9:39958404-39958426 AAAGTGGCTCTCAGCAGGAAGGG + Intergenic
1053773272 9:41505127-41505149 AAAGTGGCTCTCAGCAGGAAGGG - Intergenic
1053857744 9:42355813-42355835 GAAACAGCTCTCAGCGGAGAGGG - Intergenic
1054211400 9:62292293-62292315 AAAGTGGCTCTCAGCAGGAAGGG - Intergenic
1054253434 9:62740427-62740449 GAAACAGCTCTCAGCGGAGAGGG + Intergenic
1054313582 9:63556559-63556581 AAAGTGGCTCTCAGCAGGAAGGG + Intergenic
1054567551 9:66774926-66774948 GAAACAGCTCTCAGCGGAGAGGG + Intergenic
1055054370 9:72010531-72010553 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1055135496 9:72824485-72824507 AAATTGGCTCTCAGCAGAGAGGG + Intronic
1055240780 9:74183347-74183369 AAAGTGGCTCTCAGCAGGAAGGG + Intergenic
1055243938 9:74218029-74218051 GAAGTAGCTCTCAGCAGATAGGG - Intergenic
1055356506 9:75443041-75443063 GAAGTAGCTCTCAGCAGATTGGG + Intergenic
1055375463 9:75645137-75645159 GAAGTGGCTCTCAGCAGGAAGGG + Intergenic
1055376115 9:75649399-75649421 AAAGTGGCTCTCAGCAGGAAGGG + Intergenic
1056059562 9:82870242-82870264 GAAATGGCTCTTAGTGGAGAGGG - Intergenic
1056429832 9:86516378-86516400 GAAATGGCTCTCAGCAGAGAGGG - Intergenic
1056758581 9:89398410-89398432 GAAGTGGCTCTCAGCGGAGATGG - Intronic
1057006835 9:91568235-91568257 GAAGTGGCTCTCAGCAGGAAGGG + Intronic
1057245242 9:93450049-93450071 GAGGTTGCAGTCAGCGGAGATGG - Intronic
1057321342 9:94015817-94015839 GAAGTTGCAGTCAGCTGAGAGGG + Intergenic
1057399711 9:94712303-94712325 GAAGTGACACTCAGCCAAGAAGG - Intergenic
1057964237 9:99487933-99487955 GAACTGGCTCTCAGTGGATGGGG + Intergenic
1058206789 9:102118576-102118598 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1058311929 9:103514827-103514849 GAAGTGGCTCACAGCAGATGGGG + Intergenic
1058584464 9:106492225-106492247 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1058828039 9:108792619-108792641 AAAGTGGCTGTCAGTAGAGAAGG - Intergenic
1059042599 9:110830547-110830569 GAAGTAGCTCTCAGCGGATGGGG + Intergenic
1059327091 9:113510599-113510621 GAAGTACCTCTCAACTGAGAAGG - Intronic
1059527427 9:115005539-115005561 GAAGTGGCTCTCCTCCGACAGGG + Intergenic
1059573802 9:115468527-115468549 GAAGTGGCTCTCAGTGGGATAGG + Intergenic
1060950048 9:127595779-127595801 GAGCTGGCTCTGAGCAGAGACGG - Intergenic
1062412481 9:136432061-136432083 GGAGTGGCTCTCAGGGGAAGTGG + Intronic
1062497045 9:136836809-136836831 GAAGTGACTTTCAGGGGAGCTGG + Intronic
1062612813 9:137382691-137382713 GATGTGGCACTCAGAGGAGCTGG + Intronic
1185627811 X:1494768-1494790 GAAGTGACAGTGAGCGGAGACGG - Intronic
1185950102 X:4423026-4423048 GAAGTGGCTCTCAGCAGAAGGGG + Intergenic
1185975401 X:4714235-4714257 GAAGTGGCTCTCAGCAGAAGGGG - Intergenic
1186033212 X:5392266-5392288 AAAGTGGCTCTCAGCAGGAAGGG + Intergenic
1186213433 X:7273951-7273973 GAACAGGCTCTCAGAGGAGGTGG + Intronic
1186239002 X:7546470-7546492 AAAGCAGCTCTCAGCAGAGAGGG - Intergenic
1186820751 X:13285367-13285389 GAAACAGCTCTCAGTGGAGAGGG - Intergenic
1187365300 X:18661613-18661635 GAAGGAGCTCTCAGCAGATAGGG + Intronic
1188180600 X:27050665-27050687 AAAGTGGCTCTCAGCAGACAGGG - Intergenic
1188526563 X:31094088-31094110 GAAGTGGCTCTCAGCGGGATGGG + Intergenic
1188527004 X:31097710-31097732 GAAATGTCTCACAGTGGAGAGGG + Intronic
1188549167 X:31343367-31343389 TTAGTGTCTATCAGCGGAGAAGG + Intronic
1188554773 X:31399211-31399233 AAAGTGGCTCTCAGTGGGAAGGG + Intronic
1188587271 X:31793008-31793030 AAAGTGGCTCTCAGTGGGAAGGG + Intronic
1189129644 X:38485122-38485144 GAAGTGGCTCTCAAGGGCGTGGG - Intronic
1189676727 X:43468186-43468208 AAAATGGCTCTCAGCAGAGAGGG + Intergenic
1190167503 X:48085254-48085276 GAAGTGGCTCTCAGCAGGAAAGG + Intergenic
1190320683 X:49177602-49177624 GGAGTGGTTCTCAGAGGATAGGG + Intronic
1190487449 X:50941993-50942015 GAAATAGCTCACAGTGGAGAGGG + Intergenic
1190566122 X:51732127-51732149 GAAGTGGCTCTCAGCTGAAGGGG - Intergenic
1191766586 X:64705130-64705152 GAAGTAGCTCTCAGCAGATTGGG + Intergenic
1191767110 X:64709995-64710017 GAAGTGGCTCTCAGTGAGAAGGG + Intergenic
1192325489 X:70128466-70128488 GAAACAGCTCTCAGTGGAGAGGG + Intergenic
1192784176 X:74321548-74321570 GAGGTGGCTCTCAGCAGATGAGG - Intergenic
1193109326 X:77711768-77711790 GAAGTTGCTGTGAGCTGAGATGG + Intronic
1193144593 X:78064042-78064064 GAAGTGGCCCTCAGCAGAAGGGG + Intergenic
1193183622 X:78486878-78486900 GAAGTAGCTCTCAGCAGATAGGG + Intergenic
1193532642 X:82674792-82674814 GAAGTGGCTCTCAGTGGGAAGGG + Intergenic
1194068263 X:89288364-89288386 GAAGTAGCTCTCAGCAGTGGGGG + Intergenic
1194211271 X:91072343-91072365 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1194615915 X:96103408-96103430 AAAGTGGCTCTCAGTGGGAAGGG + Intergenic
1195721284 X:107871646-107871668 AAAGTGGCTCTCAGCAGGAAGGG + Intronic
1195722449 X:107879325-107879347 AAAGTGGCTCTCAGCGGGAAGGG + Intronic
1195853221 X:109305491-109305513 GAAATGGCTCTCAGGGGAGAAGG + Intergenic
1195854084 X:109311417-109311439 GAAATGGCTCTCAGTGGAGAGGG + Intergenic
1195858770 X:109358498-109358520 AAAGTGGCTCTCAGTGGGAAGGG - Intergenic
1196873140 X:120131503-120131525 AAAGTGGCTTTCAGTGGAGAGGG + Intergenic
1197340690 X:125263296-125263318 GAAGTGGCTCTTAGCGGGATGGG + Intergenic
1198167555 X:134072370-134072392 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1198386605 X:136134966-136134988 GAAGTAGCTCTCAGCAGATGGGG + Intergenic
1198964278 X:142210775-142210797 GAAGTAGCTCTCAGCAGATGGGG - Intergenic
1199219890 X:145305905-145305927 GAAGTGGCTTTCAGTGGGAAGGG + Intergenic
1199656341 X:149998707-149998729 GCAGTGGTTCTCAGTGGGGATGG - Intergenic
1199680468 X:150220988-150221010 GAAGAGGCACACAGGGGAGAGGG - Intergenic
1200722406 Y:6622533-6622555 GAAGTAGCTCTCAGCAGTGGGGG + Intergenic
1201238086 Y:11930805-11930827 GAGGTAGCTCTCAGCAGATAGGG - Intergenic
1201610712 Y:15840064-15840086 AAAGTGGCTCTTAGCGGGAAAGG + Intergenic
1201701187 Y:16883873-16883895 GAGGTGGCTCTCAGCAGAAGGGG + Intergenic
1201943015 Y:19479730-19479752 GAAGTGGCTGGCAGAAGAGAAGG + Intergenic
1202170423 Y:22037919-22037941 GCTGCTGCTCTCAGCGGAGAGGG - Intergenic
1202220941 Y:22548454-22548476 GCTGCTGCTCTCAGCGGAGAGGG + Intergenic
1202322171 Y:23647209-23647231 GCTGCTGCTCTCAGCGGAGAGGG - Intergenic
1202548597 Y:26022847-26022869 GCTGCTGCTCTCAGCGGAGAGGG + Intergenic