ID: 1056761129

View in Genome Browser
Species Human (GRCh38)
Location 9:89415620-89415642
Sequence CTGTCTATGAACCAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056761124_1056761129 -2 Left 1056761124 9:89415599-89415621 CCTCAACCATGTGAGAAGACGCT 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1056761129 9:89415620-89415642 CTGTCTATGAACCAGGAGGAGGG No data
1056761122_1056761129 0 Left 1056761122 9:89415597-89415619 CCCCTCAACCATGTGAGAAGACG 0: 1
1: 0
2: 2
3: 15
4: 291
Right 1056761129 9:89415620-89415642 CTGTCTATGAACCAGGAGGAGGG No data
1056761121_1056761129 5 Left 1056761121 9:89415592-89415614 CCTCACCCCTCAACCATGTGAGA 0: 1
1: 0
2: 6
3: 28
4: 270
Right 1056761129 9:89415620-89415642 CTGTCTATGAACCAGGAGGAGGG No data
1056761120_1056761129 6 Left 1056761120 9:89415591-89415613 CCCTCACCCCTCAACCATGTGAG 0: 1
1: 2
2: 11
3: 56
4: 558
Right 1056761129 9:89415620-89415642 CTGTCTATGAACCAGGAGGAGGG No data
1056761118_1056761129 17 Left 1056761118 9:89415580-89415602 CCCAGAGAGCTCCCTCACCCCTC 0: 2
1: 36
2: 114
3: 287
4: 847
Right 1056761129 9:89415620-89415642 CTGTCTATGAACCAGGAGGAGGG No data
1056761119_1056761129 16 Left 1056761119 9:89415581-89415603 CCAGAGAGCTCCCTCACCCCTCA 0: 2
1: 1
2: 49
3: 149
4: 594
Right 1056761129 9:89415620-89415642 CTGTCTATGAACCAGGAGGAGGG No data
1056761125_1056761129 -8 Left 1056761125 9:89415605-89415627 CCATGTGAGAAGACGCTGTCTAT 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1056761129 9:89415620-89415642 CTGTCTATGAACCAGGAGGAGGG No data
1056761123_1056761129 -1 Left 1056761123 9:89415598-89415620 CCCTCAACCATGTGAGAAGACGC 0: 1
1: 0
2: 0
3: 29
4: 272
Right 1056761129 9:89415620-89415642 CTGTCTATGAACCAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056761129 Original CRISPR CTGTCTATGAACCAGGAGGA GGG Intronic
No off target data available for this crispr