ID: 1056762560

View in Genome Browser
Species Human (GRCh38)
Location 9:89425622-89425644
Sequence TGCCCCTGATGTCAAAGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056762560_1056762564 12 Left 1056762560 9:89425622-89425644 CCGCTGCTTTGACATCAGGGGCA 0: 1
1: 0
2: 0
3: 18
4: 166
Right 1056762564 9:89425657-89425679 GCCTGACCCTGTGGCCCCACTGG No data
1056762560_1056762562 3 Left 1056762560 9:89425622-89425644 CCGCTGCTTTGACATCAGGGGCA 0: 1
1: 0
2: 0
3: 18
4: 166
Right 1056762562 9:89425648-89425670 GTCCTGAAAGCCTGACCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056762560 Original CRISPR TGCCCCTGATGTCAAAGCAG CGG (reversed) Intronic
902686345 1:18080067-18080089 TGCCTCTGCTGACAAAGGAGTGG - Intergenic
904331532 1:29761100-29761122 GGCCCCTGAGGTCAAAGTTGGGG + Intergenic
904453025 1:30628664-30628686 TGCCTCTGAGCACAAAGCAGGGG - Intergenic
908328637 1:63048687-63048709 TGCCCCTCCTGTCAGATCAGTGG - Intergenic
911680201 1:100706580-100706602 TGCCCTTGATTTCAATGCAGAGG - Intergenic
912216403 1:107618113-107618135 TCCCCCTCCTGTCAAATCAGTGG - Intronic
912567865 1:110601342-110601364 TGTCCTTGGTTTCAAAGCAGGGG + Intronic
913200333 1:116490956-116490978 TGACCATGATGTCAGAGCACGGG + Intergenic
913609959 1:120501357-120501379 AGCCCCAGATGTCAACTCAGGGG + Intergenic
913984829 1:143555486-143555508 AGCCCCAGATGTCAACTCAGGGG - Intergenic
914203852 1:145509781-145509803 AGCCCCAGATGTCAACTCAGGGG - Intergenic
914482975 1:148082935-148082957 AGCCCCAGATGTCAACTCAGGGG - Intergenic
914581229 1:149020884-149020906 AGCCCCAGATGTCAACTCAGGGG - Intronic
916214824 1:162385599-162385621 TGACCCTGATGTCAGAGAGGAGG + Intronic
917317191 1:173738244-173738266 TGCCCTGGAGGTCAAAGCTGGGG - Intronic
1064185871 10:13161523-13161545 TGCGTCTGACGTCAAGGCAGGGG + Intergenic
1069999476 10:72365640-72365662 TGTCCCTGGTATCAAAGCAAAGG - Intergenic
1072263805 10:93707879-93707901 TGCCCCTGATGGAAATGGAGGGG + Intergenic
1073586022 10:104710898-104710920 TGCCTCTGTTGGCCAAGCAGTGG + Intronic
1073650871 10:105356728-105356750 TGCCACTGATGTGAAAGCAAAGG + Intergenic
1074086954 10:110215467-110215489 TGCCCAAGATGACACAGCAGAGG + Intronic
1075969239 10:126638611-126638633 TTCCCCAGATGTCAAGGCACAGG - Intronic
1076184830 10:128438130-128438152 CGCCCCTGGTGACAATGCAGGGG + Intergenic
1079224861 11:18596291-18596313 TGCCCCTGGTTACAAAGGAGAGG + Intergenic
1079820281 11:25118542-25118564 TGTCCCTGATATCAAAGCATTGG + Intergenic
1080837898 11:35957436-35957458 TGACCATCATGTAAAAGCAGAGG - Intronic
1081194328 11:40142701-40142723 TGCCCCAGGTCTCAAATCAGTGG + Intronic
1081619126 11:44608527-44608549 TGCCCAGAATGTCAGAGCAGTGG - Intronic
1083755489 11:64789675-64789697 TGCCCCTGAGGCCAGAGAAGGGG - Intronic
1083860019 11:65415363-65415385 TGCCCCTGAGGACAGTGCAGTGG + Intergenic
1087216630 11:95502079-95502101 TGACCCTGCTGTCAGAGCTGCGG - Intergenic
1087667307 11:101065700-101065722 ATCTCCTGATGTCAATGCAGCGG - Intronic
1089123834 11:116162262-116162284 TGCCCCAGGTGCCCAAGCAGTGG - Intergenic
1089309478 11:117548311-117548333 TGCCCCAAATCTCAAAGCTGGGG + Intronic
1090662526 11:128891986-128892008 TGCCCCAGATCTCCCAGCAGTGG + Intronic
1091034961 11:132224613-132224635 TGCCCCTGAAGGTACAGCAGTGG + Intronic
1095248982 12:39956884-39956906 TGCCCCTGTGGAGAAAGCAGGGG + Intronic
1098460585 12:70729015-70729037 AGCCTCTGATGTGAAAGCAGTGG - Intronic
1101659053 12:106749900-106749922 TCCCCATGATGTGGAAGCAGAGG + Intronic
1103735110 12:123056145-123056167 TGGCCCTGAGGTCAAGGCAGTGG + Intronic
1104392393 12:128402027-128402049 TGGCCCTGATGTCATCACAGGGG + Intronic
1116386713 14:44339933-44339955 TGTTCTTGATGTTAAAGCAGTGG + Intergenic
1122037950 14:98962050-98962072 TGCCCAGGATGTCCCAGCAGTGG + Intergenic
1122287105 14:100658605-100658627 GGCCCCTGGTGTCAGAACAGAGG + Intergenic
1122812833 14:104297467-104297489 GGCCACTGAAGGCAAAGCAGGGG - Intergenic
1123976394 15:25558343-25558365 GGCCCCTGATGGAAAGGCAGTGG + Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1125747210 15:42005144-42005166 TGCTCCTGATGTCAAAGACTTGG - Intronic
1128245657 15:66131022-66131044 TTCCCCTGAAGTGAAACCAGGGG - Intronic
1129157579 15:73728376-73728398 TGCCCCATATGTCATCGCAGAGG - Intergenic
1129331327 15:74828899-74828921 TGCTCCTGTTGTCTAAGGAGGGG + Intronic
1129754881 15:78092205-78092227 TGCCCCTGGGAGCAAAGCAGTGG - Intronic
1131436377 15:92425976-92425998 AGCCCCAGATGTCAAAGCATTGG + Intronic
1138146430 16:54616379-54616401 GGCACCTGCTGACAAAGCAGAGG + Intergenic
1138149333 16:54641386-54641408 TGCCACTGAAGTGAAAGCTGTGG - Intergenic
1138652384 16:58468087-58468109 TCCCCATGATGTCAGAGCTGTGG - Intronic
1140395334 16:74621480-74621502 TGGCCCTGTTTTCAAAGCAGGGG + Exonic
1140510456 16:75503877-75503899 TGCCACTGCTGTCAAGGCTGAGG + Intergenic
1140516215 16:75544192-75544214 TGCCACTGCTGTCAAGGCTGAGG + Intronic
1143725734 17:8844132-8844154 TGCCTCTGATGCCACAGCAAAGG + Intronic
1146061326 17:29608969-29608991 GGCCCCTGAAGACAAAGCTGCGG - Exonic
1149775687 17:59355241-59355263 TGTCCAAGATGTCAAATCAGAGG + Intronic
1150005140 17:61464421-61464443 TGCCCCTGGTGACAAAATAGGGG + Intronic
1150791862 17:68205656-68205678 TGCCCCTAATGTCGGAGCCGAGG - Intergenic
1152265096 17:79289472-79289494 TGCCCCTGACTTCAGAGCTGAGG + Intronic
1152333551 17:79686933-79686955 TGCCCCTGAAGACAAAGCACAGG + Intergenic
1152444553 17:80333968-80333990 TGTGCCTGTTGTCACAGCAGTGG + Intronic
1152492174 17:80643506-80643528 TGCCCGTGATGTTAAAACACTGG + Intronic
1152912927 17:83015708-83015730 TGCCCCTCCTGTCAGAGCAGCGG + Intronic
1155591157 18:27428810-27428832 TGCCTCTGGTGTCATAGCTGAGG + Intergenic
1157389239 18:47287579-47287601 TCCAACTGATTTCAAAGCAGTGG + Intergenic
1157985015 18:52427513-52427535 TGAGCCTCATGACAAAGCAGAGG + Intronic
1158567510 18:58567754-58567776 GGCCCCTGCTGCCAATGCAGAGG - Intronic
1159465778 18:68782546-68782568 TAACTCTGATGTCAAAGCAGAGG - Intronic
1160355659 18:78226413-78226435 TGGCCCTGGTGTCACAGCTGGGG - Intergenic
1161444394 19:4310332-4310354 TGCCCCTGGTGTGAAGACAGGGG + Intronic
1162688558 19:12409267-12409289 TGCACATGCTGTCAAACCAGTGG - Intronic
1166003045 19:39889652-39889674 TGCCCATGAAGTCGAAGCGGTGG + Exonic
1166005832 19:39905904-39905926 TGCCCATGAAGTCGAAGCGGTGG + Exonic
928031105 2:27780176-27780198 TGCCCCAGAAGTCTTAGCAGTGG - Intronic
930145745 2:48002510-48002532 TACCCCAGATGGAAAAGCAGGGG - Intergenic
931217951 2:60263790-60263812 CGATCCTGATGTCAAAGTAGGGG - Intergenic
931221670 2:60294415-60294437 TCCCACTGATGACAATGCAGTGG - Intergenic
931859214 2:66336151-66336173 TTCCCCTGCTCTGAAAGCAGGGG + Intergenic
932145516 2:69312437-69312459 TGTCCCTGATCTCAAAGGAAAGG - Intergenic
933541161 2:83644308-83644330 TGACTGTGATGTCAAAGAAGAGG - Intergenic
936084299 2:109456030-109456052 TGCACCTGATGACAGAGCATGGG - Intronic
936559629 2:113525968-113525990 TCCCACTCATGTCAAGGCAGAGG - Intergenic
937647135 2:124277950-124277972 TGCCCCTGTTCTCCCAGCAGAGG + Intronic
940804940 2:158176112-158176134 TGATACTGATGACAAAGCAGAGG - Intronic
940918366 2:159282722-159282744 TGCCCCTGATGCCAAACACGTGG + Exonic
944567843 2:201009050-201009072 TGCCCCTTCTGTCAAAGCCATGG + Exonic
945134783 2:206615597-206615619 TTCCACTGATGTCCCAGCAGGGG - Intronic
946167179 2:217871443-217871465 TGCCCCTTGTATCTAAGCAGAGG - Intronic
948129012 2:235586516-235586538 TGCTCCTTATGTCCATGCAGAGG + Intronic
1168759627 20:341051-341073 GGCCCCTGATATCAGAGCAGGGG - Intergenic
1169622356 20:7521783-7521805 TTCCCCTGTTGTCAAAGAAAAGG - Intergenic
1172567457 20:35941831-35941853 TGTGGCTGATGTCAATGCAGAGG + Intronic
1172612751 20:36263986-36264008 AGCCCTTGATGTCCAAGGAGGGG - Intronic
1176295631 21:5070571-5070593 TGCCACTGATGGGACAGCAGTGG + Intergenic
1178130928 21:29572044-29572066 AGACCCTGATGGCACAGCAGAGG + Intronic
1179097497 21:38328719-38328741 TCCACCTGCTGTCAAATCAGTGG - Intergenic
1179861418 21:44191553-44191575 TGCCACTGATGGGACAGCAGTGG - Intergenic
1181757011 22:25031234-25031256 TGCCGCTGAGGCCAGAGCAGTGG + Intronic
1182320988 22:29478614-29478636 TTCCCCTAAAGTAAAAGCAGAGG + Intergenic
1184023850 22:41839123-41839145 TGTCCCTGAAGGCAGAGCAGAGG + Intronic
1185100326 22:48836859-48836881 CGCCCCAGACCTCAAAGCAGAGG - Intronic
950290921 3:11783744-11783766 TGCCCATGATGACTGAGCAGTGG + Intergenic
950359628 3:12441199-12441221 TGCCGCTGCTGCCACAGCAGTGG + Intergenic
950387123 3:12668989-12669011 TGCCCATGATGTCAGATCAGAGG + Intergenic
951520813 3:23609313-23609335 GGCTCCAGATGCCAAAGCAGAGG + Intergenic
952617540 3:35292959-35292981 TGCCCCTGTTGCCAGAGCAGTGG + Intergenic
955693695 3:61614790-61614812 TGCTACTGAGCTCAAAGCAGTGG - Intronic
956877755 3:73480217-73480239 AGCCACTGTTGTCAAAACAGTGG + Intronic
959556079 3:107720013-107720035 TGCCTCTGATGCTAAAACAGTGG - Intronic
959600763 3:108182239-108182261 TCCCCCTCATTCCAAAGCAGTGG - Intronic
960149089 3:114232586-114232608 GGCCCCTGAAGTCCAAGAAGAGG + Intergenic
960948602 3:122983882-122983904 TACCCCTGCTGTGGAAGCAGAGG + Intronic
961076939 3:123991602-123991624 TGTCGCTGATGAAAAAGCAGAGG + Intronic
961307642 3:125969709-125969731 TGTCGCTGATGAAAAAGCAGAGG - Intronic
962159927 3:132988480-132988502 TGCCACAGATGTCAAAACAGTGG + Intergenic
964850179 3:161087697-161087719 TGTTCCTGATCTCAAGGCAGAGG + Intronic
969681480 4:8645645-8645667 TGCCCCTCATATCACAGGAGGGG + Intergenic
970829866 4:20324402-20324424 TGCCATTGGTGTTAAAGCAGAGG + Intronic
973148596 4:46860549-46860571 TTCACCAGATGTCAAAGAAGGGG - Intronic
973256880 4:48122448-48122470 TGGCCGTAATGTCAAATCAGGGG - Intronic
986429856 5:7670790-7670812 TGCCGCTGATCTGACAGCAGAGG + Intronic
986855839 5:11868008-11868030 AACCCCTGATGGCGAAGCAGGGG + Intronic
988797269 5:34663164-34663186 TGGGCCTGATGTCAAAGACGAGG - Intronic
990471979 5:56123907-56123929 TGCCTCAGCTGTCACAGCAGGGG + Intronic
991349237 5:65703600-65703622 TCCACCTGATGTCCCAGCAGAGG + Intronic
992778178 5:80105997-80106019 TGCACCTGAGGACAGAGCAGGGG + Intergenic
996791518 5:127298480-127298502 TGCCTCTGAAGTCAGAGCACAGG - Intronic
997269577 5:132525617-132525639 TGCCCTTGTTGTCAGAGCACTGG - Intergenic
997744028 5:136283136-136283158 CGCCCCTGAGGACACAGCAGAGG - Intronic
999398724 5:151248249-151248271 GGCCCCTGCTGTCAACGCAAAGG - Intronic
1001450212 5:171818774-171818796 TGCCCCTGGGGGCAAAGCAAAGG + Intergenic
1001818128 5:174688576-174688598 AGCCCCAGATGTAAAATCAGAGG + Intergenic
1002019499 5:176353856-176353878 TGCCTGTGATGTCAGAGCAATGG - Intronic
1004054506 6:12121951-12121973 TTCCCCTGTGGGCAAAGCAGAGG - Exonic
1004276196 6:14237196-14237218 AGCCCCTGATGCCAAAGCAAAGG - Intergenic
1005029977 6:21499601-21499623 TGCTCAAGATGGCAAAGCAGGGG - Intergenic
1005925143 6:30438240-30438262 AGCCCAAGAAGTCAAAGCAGCGG + Intergenic
1006389803 6:33751681-33751703 TTCCCCTCATTTCACAGCAGAGG + Intergenic
1006729905 6:36229030-36229052 TGCGCTTGTTGTCAAAGAAGAGG - Exonic
1006840978 6:37027761-37027783 TGCCTCTGAGGGCAAAGCAGTGG - Intronic
1008046771 6:46859265-46859287 TGCCCCAGAGGTCAAAGTATGGG + Exonic
1012371343 6:98511221-98511243 TACCCCTCATGTCAGATCAGCGG + Intergenic
1012372900 6:98528925-98528947 TGCCCCTGTAGTCACGGCAGTGG - Intergenic
1012731564 6:102888447-102888469 TGCCCCGGAAGTCAAAGAAGGGG + Intergenic
1019815206 7:3194907-3194929 GGCCCCAGATGTCAGAGCATTGG + Intergenic
1026809161 7:73447846-73447868 TGACCATAATATCAAAGCAGTGG + Intronic
1030064487 7:105648858-105648880 TGCCCATACTGTGAAAGCAGGGG - Intronic
1032303300 7:130709591-130709613 TTCTCCTGATCTCAAAGCACAGG + Intergenic
1033975833 7:147099359-147099381 GGCCCCAGATGTCAAAGCATTGG + Intronic
1035473043 7:159122588-159122610 TGCCTCTAATGTGAAAGCACAGG + Intronic
1036780646 8:11644636-11644658 TGCCCTGGATTTCAGAGCAGCGG - Intergenic
1038148159 8:24917403-24917425 TGCACCTGAAGTTAAAGAAGAGG + Exonic
1038305908 8:26401681-26401703 TGCATCTGAAATCAAAGCAGTGG + Intronic
1039326674 8:36492840-36492862 TGCCACTGATTTCAAAAGAGTGG + Intergenic
1041826625 8:62102108-62102130 TTCCCCTGCTTTTAAAGCAGAGG + Intergenic
1042764775 8:72308964-72308986 TGTCCATGCTGGCAAAGCAGTGG + Intergenic
1044015733 8:87047165-87047187 TTCCTCTGCTTTCAAAGCAGAGG + Intronic
1044299135 8:90563629-90563651 CCCCCCTCATTTCAAAGCAGAGG - Intergenic
1048198239 8:132350490-132350512 TGGCACTGATTCCAAAGCAGGGG + Intronic
1048702194 8:137104487-137104509 TGGCCCTGAAGGCAAAGAAGAGG + Intergenic
1049893239 9:90404-90426 TCCCACTCATGTCAAGGCAGAGG + Intergenic
1051000194 9:12272831-12272853 TGCCTCTAAACTCAAAGCAGAGG - Intergenic
1053135629 9:35648889-35648911 GGCTACTGATGTCAAAACAGGGG + Intergenic
1053734451 9:41090458-41090480 TCCCACTCATGTCAAGGCAGAGG + Intergenic
1053901017 9:42795628-42795650 TGCCCCAGAGGTCAAAGTATGGG - Intergenic
1054260627 9:62861935-62861957 TGCCCCAGAGGTCAAAGTATGGG + Intergenic
1054693935 9:68341115-68341137 TCCCACTCATGTCAAGGCAGAGG - Intronic
1056762560 9:89425622-89425644 TGCCCCTGATGTCAAAGCAGCGG - Intronic
1059383791 9:113948731-113948753 AGTCCCTGATGTTGAAGCAGTGG + Intronic
1060103322 9:120858217-120858239 TGCCCCTGCGGGCAAAGCGGTGG - Exonic
1060932946 9:127500399-127500421 TGCTTCTGATGTCTTAGCAGGGG + Intronic
1061041610 9:128144125-128144147 TGCCCATCATGGCAATGCAGAGG + Intergenic
1061312179 9:129771003-129771025 TGGCCCTCTAGTCAAAGCAGGGG - Intergenic
1187493553 X:19775078-19775100 GTCCCCTGATGTCAAACCACAGG - Intronic
1188528262 X:31109182-31109204 TGTCCTTGATGACAAAACAGTGG + Intronic
1190677602 X:52795534-52795556 TGAGCCTCATTTCAAAGCAGTGG - Intergenic
1191041307 X:56083731-56083753 TCCGCCTGCTGTCAAATCAGTGG + Intergenic
1192234082 X:69285236-69285258 TGCCCCTGAAGACAATGGAGAGG - Intergenic
1195070956 X:101279014-101279036 GGTCCCTGATGTCAAAGAAATGG - Exonic