ID: 1056763070

View in Genome Browser
Species Human (GRCh38)
Location 9:89428324-89428346
Sequence CAGGGCCAGGGACTGTGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 1, 2: 13, 3: 53, 4: 348}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056763070_1056763078 -5 Left 1056763070 9:89428324-89428346 CCCAAACACAGTCCCTGGCCCTG 0: 1
1: 1
2: 13
3: 53
4: 348
Right 1056763078 9:89428342-89428364 CCCTGCAGGGGAACCTGAACTGG No data
1056763070_1056763080 -1 Left 1056763070 9:89428324-89428346 CCCAAACACAGTCCCTGGCCCTG 0: 1
1: 1
2: 13
3: 53
4: 348
Right 1056763080 9:89428346-89428368 GCAGGGGAACCTGAACTGGAAGG No data
1056763070_1056763082 6 Left 1056763070 9:89428324-89428346 CCCAAACACAGTCCCTGGCCCTG 0: 1
1: 1
2: 13
3: 53
4: 348
Right 1056763082 9:89428353-89428375 AACCTGAACTGGAAGGACGAGGG No data
1056763070_1056763081 5 Left 1056763070 9:89428324-89428346 CCCAAACACAGTCCCTGGCCCTG 0: 1
1: 1
2: 13
3: 53
4: 348
Right 1056763081 9:89428352-89428374 GAACCTGAACTGGAAGGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056763070 Original CRISPR CAGGGCCAGGGACTGTGTTT GGG (reversed) Intronic
900398161 1:2461796-2461818 CAGGGCTGGGGCCTTTGTTTGGG + Intronic
900489808 1:2942202-2942224 CAGGGCCAGGGGCTGAGTTTTGG + Intergenic
900573728 1:3372837-3372859 CAGGGCCACGGACGGGGTTCTGG + Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
901169698 1:7247680-7247702 GAGGTCCACGGACTGTGCTTAGG - Intronic
901192237 1:7419595-7419617 CAGGCCCAGGGAATCAGTTTGGG - Intronic
901219884 1:7577523-7577545 CGTGCCCAGGGACTTTGTTTTGG + Intronic
902340193 1:15778102-15778124 CAGGGCCAGTCACTGTGGCTGGG + Intronic
903060417 1:20664873-20664895 CAGGGCCAGGGCCTCTGGCTGGG - Intronic
904061553 1:27714982-27715004 CAGTCCCAGGGAATGTGTGTAGG - Intergenic
904568447 1:31442690-31442712 CAGGGCCAAGTACTGTGATCAGG + Intergenic
904761775 1:32810335-32810357 CAAGGCCAAGGACTTTGTTTTGG + Intronic
904822455 1:33255101-33255123 CTGTGCCAGGCACTGTGCTTGGG + Intergenic
906191016 1:43899498-43899520 CAGAGCCTGGGCCTGTGTTTGGG - Intronic
907392789 1:54169142-54169164 CCGTGCCAGGTGCTGTGTTTGGG + Intronic
907427291 1:54388423-54388445 CCAGGCCAGGCACTGTGTGTGGG - Intronic
907944940 1:59127320-59127342 CAGTGCCAGGCACTGTGCTATGG + Intergenic
908316234 1:62935447-62935469 CTGGGCCATGGACTGTACTTAGG - Intergenic
908784375 1:67720596-67720618 CTGTGCCAGGCACTGTGTTAAGG + Intronic
912172387 1:107116540-107116562 CTGGTCCAGGGATTGTATTTGGG - Intergenic
913958371 1:143322223-143322245 CAGGGCCAGGGGCTGCGTTAGGG + Intergenic
914052686 1:144147598-144147620 CAGGGCCAGGGGCTGCGTTAGGG + Intergenic
914126511 1:144818943-144818965 CAGGGCCAGGGGCTGCGTTAGGG - Intergenic
915591803 1:156875114-156875136 CAGGGCGTGTGAGTGTGTTTGGG + Intronic
916522116 1:165573019-165573041 CAGGGCCATGGAAAGGGTTTTGG + Intergenic
917277444 1:173345979-173346001 CAGGGCCAGGGACTTTGGGTAGG + Intergenic
918795311 1:188887539-188887561 CAGGGCCTGGGTCTGGGTGTGGG - Intergenic
919605444 1:199676613-199676635 CAGGGTCAGGGATACTGTTTAGG + Intergenic
919755225 1:201062316-201062338 CAGGGCAGGGGACTGTGTGTTGG - Intronic
919835547 1:201570665-201570687 CAGGGCCAGGGCCAGGGTATGGG + Intergenic
920371746 1:205483499-205483521 CAGGGCAAGGGTATGTGTTGAGG - Intergenic
920809376 1:209267936-209267958 CTGGGATTGGGACTGTGTTTGGG - Intergenic
921904067 1:220477720-220477742 CAGGGCCTGAAACTGTGTTGGGG + Intergenic
923512173 1:234662046-234662068 CTGTGCCAGGGATTGTGTTAGGG + Intergenic
923852030 1:237806560-237806582 ATGGGCCAGGGGCTGTGTTAAGG - Intronic
923921498 1:238569461-238569483 CTGGGCCATGCATTGTGTTTCGG - Intergenic
1063149838 10:3326372-3326394 CAGGGACAGGGACTGGGGCTTGG - Intergenic
1064136510 10:12755236-12755258 CAGGAGCAGGGAGTGTGTGTAGG + Intronic
1064166921 10:12994524-12994546 AAGGGCCTGGGACTTTGCTTAGG - Intronic
1065510692 10:26475504-26475526 CAGGGCCTGGGATTGTGTGAAGG - Intronic
1065901162 10:30209428-30209450 CAGGGCCATAGACCTTGTTTAGG - Intergenic
1066759296 10:38738344-38738366 CAGGGCCAGGGGCTGCGTTAGGG - Intergenic
1066962333 10:42234435-42234457 CAGGGCCAGGGGCTGTGTTAGGG + Intergenic
1067213626 10:44282056-44282078 CAGGGCAGGGCTCTGTGTTTGGG - Intergenic
1067545870 10:47192464-47192486 CAGGGCCAGGGACTGCCTTCCGG - Intergenic
1067728503 10:48791696-48791718 CAGGGCCAGGGTCGGAGTCTGGG + Intronic
1069776608 10:70930958-70930980 CAGGACCGGGAACTGTTTTTTGG - Intergenic
1071478823 10:86047543-86047565 CAGGGTTAGGAACTCTGTTTAGG - Intronic
1072781776 10:98256442-98256464 CAGGGCCAGGGATTGTAGTGTGG - Intronic
1072925662 10:99614331-99614353 CAGGGCCAGGGGCACTCTTTAGG - Intronic
1073243527 10:102073754-102073776 CAGGCCCAGGCCCTCTGTTTGGG - Intergenic
1075675494 10:124293146-124293168 CAGCGCCAGGGCCTGTGATGAGG + Intergenic
1076500837 10:130934730-130934752 CCTGGCCAGGGCCTCTGTTTTGG - Intergenic
1076837024 10:133026240-133026262 CAGGGGCAGGTACTCTGTGTGGG + Intergenic
1077673520 11:4178954-4178976 CAGGCCCTGGGAAAGTGTTTGGG + Intergenic
1078145392 11:8718777-8718799 CAAGGGCAGGGATTCTGTTTTGG - Intronic
1078190762 11:9091334-9091356 CAGGGCCAGGAAGAGTGTTTAGG - Intronic
1078287257 11:9969701-9969723 CAGGGATAGGGAGTGTGTTGGGG - Intronic
1078312454 11:10258669-10258691 GAGGGCCAGTGACCATGTTTTGG + Intronic
1078350230 11:10586816-10586838 CAGGAAGAAGGACTGTGTTTGGG + Intronic
1078464079 11:11537653-11537675 CAAGTCCAAGGACTGGGTTTTGG - Intronic
1079289770 11:19177239-19177261 CAGGGCCAGGGTGGGTGTCTAGG + Intergenic
1079375810 11:19890811-19890833 CAGTGCCAGTGCCTGTGTTTGGG - Intronic
1079761825 11:24338751-24338773 CAGGGGGAGGGACAGTGATTGGG + Intergenic
1081815549 11:45938143-45938165 CAGGACCAGGTACTGTGGGTGGG - Exonic
1081998092 11:47377539-47377561 CAAGGACAGGGACTGGGTCTTGG - Intronic
1083486889 11:62988683-62988705 CTGGGCCCGGAATTGTGTTTGGG + Intergenic
1083616283 11:64028229-64028251 CAGCGCCAGGGCCTGTGCTGAGG + Intronic
1083653929 11:64220025-64220047 CAGGGCCAGGGGCTGGGTGGGGG + Intronic
1083713110 11:64560662-64560684 CAGAGCCAGGCACTGTGATGAGG - Intronic
1084412615 11:69013268-69013290 CCGGGCCAGGAATTGGGTTTGGG - Exonic
1085205601 11:74730542-74730564 GAGGGCAGGGCACTGTGTTTTGG - Intronic
1085251565 11:75147445-75147467 AAGAGCCAGGGGCTGTGTTGAGG + Intronic
1086890044 11:92246723-92246745 CAGCACCAGGGGCTGTGTTGGGG + Intergenic
1089301428 11:117501452-117501474 CAGGGGCAGGGCCTCTGTCTGGG - Intronic
1089794869 11:120972202-120972224 CAGTGCCCTGGACTGGGTTTGGG + Intronic
1089993774 11:122885322-122885344 CAGGTTCAGGGGCTATGTTTTGG - Intronic
1091926514 12:4355675-4355697 CAAGGACAGAGACTTTGTTTTGG - Intergenic
1092502822 12:9065104-9065126 CTGGGCCCGGGACTGTGTCCGGG - Intergenic
1092667208 12:10815985-10816007 CAGGGCCTGGGACTGTGGGTTGG - Intergenic
1092722718 12:11457886-11457908 TAGGGCCAGAAACTTTGTTTTGG - Intronic
1094175171 12:27533945-27533967 CAGGACCAGGGACAGTCTGTTGG - Intronic
1095628070 12:44341620-44341642 CTTGGCCTGTGACTGTGTTTGGG + Intronic
1095828211 12:46553032-46553054 CAAGGATAGGGACTGTGCTTCGG + Intergenic
1095952710 12:47790349-47790371 GAGGCCCAGGGACTGGGTTTGGG - Intronic
1097181403 12:57174030-57174052 CTGGGCCAAGGACAGTCTTTGGG + Intronic
1097274583 12:57803774-57803796 CAGGCTGAGGGACTGTGGTTTGG - Intronic
1097597503 12:61652617-61652639 CAGGCCCAGGGACAATGGTTAGG + Intergenic
1098595244 12:72266642-72266664 CAGTGCCAGGCACTGTGCTAGGG - Intronic
1099968749 12:89478517-89478539 CAGTGCCAGGCACTGTGTCTGGG - Intronic
1100362293 12:93889847-93889869 CAGGGCTTGGGGCTTTGTTTTGG + Intronic
1101806991 12:108072644-108072666 CTGGGCCAGGTCCTGTGCTTAGG - Intergenic
1101892643 12:108730970-108730992 CAGGCCTGGGGACTGGGTTTGGG - Intronic
1103323941 12:120108107-120108129 CAGGAGCAGGGACTGTGTCCCGG + Intronic
1103597272 12:122031362-122031384 CAGGGCTTGGCACTGTGTTTTGG + Intronic
1103847103 12:123909151-123909173 TAGCTCCAGGGACTGTCTTTTGG + Intronic
1104640638 12:130464807-130464829 CTGGGCCAGTGAGTGTGTTAGGG - Intronic
1104787820 12:131461226-131461248 CACTGCCAGGGACTGTGCTGAGG - Intergenic
1105775236 13:23653634-23653656 GAGGGGCAGGGAGTGTGTTGAGG + Intronic
1107238217 13:38198538-38198560 GAGGTCCAGGGACTGTATCTAGG + Intergenic
1107504468 13:41018795-41018817 CAGGGGCAGTGGCTTTGTTTTGG - Intronic
1107647343 13:42508785-42508807 AAAGGCCAGGGAATGTGTGTAGG + Intergenic
1108364232 13:49693958-49693980 CAGGGCCGAGGACTGGGTTGTGG - Intergenic
1109440907 13:62371911-62371933 CACAGCCAGGCACTGTGTTATGG + Intergenic
1112091482 13:96089212-96089234 CAGGTCTAGGGACTGTGGTAGGG + Intergenic
1112821115 13:103336894-103336916 CAGAGACAGGAACTGTGATTAGG - Intergenic
1113878316 13:113608252-113608274 CAGGGCCAGGGACTGGCACTGGG - Intronic
1113891014 13:113735703-113735725 CAGGGGCAGAGACTCGGTTTTGG + Exonic
1113956441 13:114102044-114102066 CAAGGCTGGGGACTGTGTGTCGG - Intronic
1114473451 14:22979281-22979303 GAGGGCTAGGGCCTGTCTTTGGG + Intronic
1117963720 14:61186869-61186891 CAGGGCCATGGTCTTGGTTTAGG + Intergenic
1118604588 14:67493422-67493444 CAGGAACAGGGTCTGTGTTAGGG + Intronic
1121199407 14:92105257-92105279 CAGGGCCAGGTAATGTTTTTGGG - Intronic
1121220018 14:92278062-92278084 CAGGGCCAGGGGCTATTTCTTGG + Intergenic
1121510601 14:94510059-94510081 CAGGGCCTGGGCCTGTGGTCTGG + Intronic
1122270450 14:100566586-100566608 CTGGGCCAGAGCCTGAGTTTGGG + Intronic
1122513749 14:102291325-102291347 CAGGGCCAGGGCCTGTATTTTGG - Intronic
1122902056 14:104786074-104786096 CAGGGACAGGGACAGGGTCTTGG - Intronic
1122959570 14:105088270-105088292 CAGGGCCTGGGACCGGGTTGGGG - Intergenic
1202930040 14_KI270725v1_random:27961-27983 CAGGACCAGGGGCTGCGTTAGGG - Intergenic
1123422264 15:20143271-20143293 CAGGGCCAGGGGCTGCGTTAGGG + Intergenic
1123442736 15:20303070-20303092 CAGGGCCAGGGGCTGCGTTAGGG - Intergenic
1123531492 15:21149811-21149833 CAGGGCCAGGGGCTGCGTTAGGG + Intergenic
1123987265 15:25656856-25656878 CAGGGGCAGGGACAATGATTGGG + Intergenic
1124155650 15:27223280-27223302 AAAGGCCAGGGACTCTGTCTAGG + Intronic
1126436805 15:48645460-48645482 CAGGGACAGGGACTGGGGTGAGG - Intronic
1127349684 15:58138185-58138207 CAGGGCCCGTCACTGTGATTTGG + Exonic
1127969573 15:63947781-63947803 CAGGGCCTGGAAATGTGGTTAGG - Intronic
1130205302 15:81869936-81869958 CAGGGCCATGCACTGTCTCTGGG + Intergenic
1130262956 15:82373774-82373796 CAGAGGCAGGGGCTGTGTTAGGG - Intergenic
1130966425 15:88700964-88700986 CAGGGCCTGGGGCTGTGTGTGGG - Intergenic
1131401919 15:92131963-92131985 CAGGGACAGGGGCTCTGTTATGG + Intronic
1131602406 15:93862908-93862930 CAGGGCCAGAGACTGAGCTACGG + Intergenic
1132379799 15:101358520-101358542 CAGGGGCAGGAACTGTGTCTTGG + Intronic
1132552165 16:558008-558030 CAGTGACTGGGACTCTGTTTTGG - Intergenic
1132946031 16:2531914-2531936 CCAGGCCAGAGACTGCGTTTGGG + Intergenic
1133194536 16:4159549-4159571 CTGGGCCAAGGACTGTGTGTAGG + Intergenic
1133804440 16:9114003-9114025 AAGTGCCAGGCACTGTGCTTAGG + Intronic
1135475310 16:22769310-22769332 CAGTGCCAGCAACTGTGTTAGGG + Intergenic
1136457970 16:30392904-30392926 CAGGGCCTAGGACAGTGTTTAGG + Intronic
1136665791 16:31811222-31811244 CACGGCCAGGGAGTGTGTGGAGG + Intergenic
1136718521 16:32302656-32302678 CAGGGTCAGGGGCTGCGTTAGGG + Intergenic
1136723495 16:32340841-32340863 CAGGGCCAGGGGCTGTGTTAGGG + Intergenic
1136773443 16:32859494-32859516 CAGGGCCAGGGGCTGCGTTAGGG - Intergenic
1136836893 16:33508920-33508942 CAGGGTCAGGGGCTGCGTTAGGG + Intergenic
1136841829 16:33546897-33546919 CAGGGCCAGGGGCTGTGTTAGGG + Intergenic
1136862489 16:33712078-33712100 CAGGGCCAGGGGCTGTGTTAGGG - Intergenic
1136897169 16:34002025-34002047 CAGGGCCAGGGGCTGCGTTAGGG + Intergenic
1137750555 16:50858347-50858369 CAGGGACAGCGACTGAATTTGGG + Intergenic
1138578181 16:57922243-57922265 CATGGCCAAGGACTGTGATTGGG + Intronic
1140747770 16:77996169-77996191 CAGGGATAGGGACTGCGTTAGGG + Intergenic
1140838318 16:78815914-78815936 CAGGGCCAGTGAATGGGTTGGGG - Intronic
1141502515 16:84453633-84453655 CTGGGCCCGTGACTGTGTTCTGG - Intronic
1142006597 16:87692297-87692319 CAGGGCCTGGAACAGTGCTTAGG - Intronic
1142075759 16:88116803-88116825 CAGGGCTGGGGACTGTGGGTCGG + Intronic
1142259247 16:89034910-89034932 GAGGGGCAGGGCCTGTGTTGAGG + Intergenic
1203002937 16_KI270728v1_random:176924-176946 CAGGGCCAGGGGCTGTGTTAGGG - Intergenic
1203007910 16_KI270728v1_random:215115-215137 CAGGGTCAGGGGCTGCGTTAGGG - Intergenic
1203075859 16_KI270728v1_random:1121604-1121626 CAGGGCCAGGGGCTGCATTAGGG - Intergenic
1203123979 16_KI270728v1_random:1560260-1560282 CAGGTCCAGGGGCTGTGTTAGGG - Intergenic
1203134542 16_KI270728v1_random:1713330-1713352 CAGGGCCAGGGGCTGTGTTAGGG - Intergenic
1203147068 16_KI270728v1_random:1809199-1809221 CAGGGTCAGGGGCTGCGTTAGGG + Intergenic
1203151994 16_KI270728v1_random:1847194-1847216 CAGGGCCAGGGGCTGTGTTAGGG + Intergenic
1142467181 17:142700-142722 CAGGGTCAGGGTCAGGGTTTAGG - Intergenic
1143136793 17:4716643-4716665 CTGGGGCTGGGACTGTGTCTGGG + Exonic
1144214986 17:13047354-13047376 CAGGGCCCTGGACTCTGTTGTGG + Intergenic
1144787251 17:17838722-17838744 CAGAGGCAGGGAGGGTGTTTTGG + Intergenic
1145229919 17:21166092-21166114 CAGGGCCCGGGGCTGGGCTTTGG + Intronic
1145913377 17:28555628-28555650 CAGGTCCATGGAGTGTGATTAGG - Intronic
1145933652 17:28702795-28702817 AAGGGCCAGGGCCAGTGTGTTGG - Intergenic
1147317127 17:39626440-39626462 CATAGCCAGGGAGTGTGTTTTGG - Intergenic
1147560666 17:41507061-41507083 CAGGGCCAGGGTCTCAGCTTAGG + Intergenic
1148051649 17:44772596-44772618 GGGGGCCAGGGACCGTGTCTGGG + Intronic
1149419649 17:56497045-56497067 CAAGGACAGGGATTGTGTTTTGG - Intronic
1149727563 17:58912008-58912030 CAGGGATAGGGACTGCGTTAGGG - Intronic
1150217963 17:63480757-63480779 CAGGGCCAGAGCCTTTGGTTTGG - Intergenic
1150286780 17:63959228-63959250 CAGGGCCAGGGGCTGGGATGGGG - Intronic
1151359235 17:73578690-73578712 CAGGGGCAGGGATTGGGGTTGGG + Intronic
1151836821 17:76587237-76587259 CAGGGCCTGGGCCTGTGGTCAGG + Intergenic
1152252367 17:79218706-79218728 CAGGCTCAGGGAATGTCTTTGGG + Intronic
1152809682 17:82375572-82375594 GAGGGGCAGGGCCTGTGATTTGG - Exonic
1152903286 17:82957286-82957308 CGGGGCCAGGGCCTGTGCTGTGG + Intronic
1153884068 18:9447436-9447458 CAGGGATAGGGACTGCGTTAAGG + Intergenic
1154230901 18:12555249-12555271 AAGTGCCAGGGATTCTGTTTAGG - Intronic
1154415338 18:14172920-14172942 GAGGTCCAGGGTCTGTGTTAGGG + Intergenic
1155642184 18:28031508-28031530 AAGGGCCAGGGGCTTTGTTAAGG - Intronic
1155921452 18:31607422-31607444 CAGAGCCCAGGGCTGTGTTTTGG + Intergenic
1156300484 18:35832206-35832228 CAGGAGCAGGGTCTGTGTTAGGG + Intergenic
1156479297 18:37426148-37426170 CATGGCCAGGACCTGTGCTTGGG - Intronic
1156822785 18:41392801-41392823 CAGGTCCAGGCACTTTGCTTTGG + Intergenic
1156929510 18:42624931-42624953 CAGTGCCAGGGGCAATGTTTTGG + Intergenic
1157202600 18:45671870-45671892 CAGCCACAGGGACTGTGTTTTGG - Intronic
1157764411 18:50286094-50286116 CAGGGTCAGGGACAGGGGTTGGG - Exonic
1159034555 18:63264280-63264302 CAGTGCCAGGGAGAGGGTTTAGG - Intronic
1159602635 18:70443205-70443227 CAGGGACAGGAACTGTGTTAGGG - Intergenic
1159994632 18:74952331-74952353 CAGCACCAGGGGCTGTGGTTGGG - Intronic
1160442536 18:78903297-78903319 TAGGGCCAGGGACTTTGTGGGGG + Intergenic
1160934143 19:1585284-1585306 CTGGGGCTGGGACTGGGTTTGGG - Intronic
1161684235 19:5695188-5695210 CAGGCCCTGGGTCTGTGTATGGG - Intronic
1162834695 19:13308550-13308572 CATGTCCAGGGACAGTGTCTGGG + Intronic
1165065138 19:33224410-33224432 CCTGGCCAGGGGCTGTGTTCAGG + Intronic
1165328294 19:35126636-35126658 CGGGGCCAGGGTCTGCGTTGGGG + Exonic
1165801026 19:38550245-38550267 CAGAACCAGGGATTGTATTTAGG + Intronic
1165858737 19:38895371-38895393 CAAGGGCAGGGACTTTGTCTGGG + Intronic
1166641417 19:44498081-44498103 CAGGGCCTGGGAGGGTGTTAGGG - Intronic
1168080744 19:54008426-54008448 CAGGGTCAGGAACTGGGGTTGGG + Intronic
1168344347 19:55643100-55643122 CAGAGCCAGGGGGTGTGTGTGGG - Exonic
1202692083 1_KI270712v1_random:100022-100044 CAGGGCCAGGGGCTGCGTTAGGG + Intergenic
925128161 2:1476553-1476575 CAGTGCCATGGACTTGGTTTAGG - Intronic
925907614 2:8548534-8548556 CAGGGACAGGAGCTGTGTCTGGG + Intergenic
926197280 2:10771642-10771664 CAGGGCCAGGCTCTGTGCTGGGG - Intronic
927102681 2:19800059-19800081 CTGGGACAGGGACTGGGGTTTGG - Intergenic
927720463 2:25378840-25378862 GTGGGTCAGGGACTGTGATTCGG + Intronic
928300027 2:30116852-30116874 CAGGGCCAGGGACTGTGTCTGGG - Intergenic
930021838 2:47006475-47006497 CAGGGGCAGGAACTGGGTTTCGG + Intronic
933632005 2:84669732-84669754 GAGGGCCAGCGTTTGTGTTTAGG + Intronic
933954315 2:87353950-87353972 CAGGGCCAGGGGCTGCGTTAGGG - Intergenic
933955063 2:87356895-87356917 CAGGGCCAGGGCCAGTGCTCAGG - Intergenic
934238512 2:90250170-90250192 CAGGGCCAGGGGCTGCGTTAGGG - Intergenic
934239254 2:90253109-90253131 CAGGGCCAGGGCCAGTGCTCAGG - Intergenic
934273932 2:91563589-91563611 CAGGGCCAGGGCCAGTGCTCAGG + Intergenic
934274682 2:91566540-91566562 CAGGACCAGGGGCTGCGTTAGGG + Intergenic
934322623 2:91982695-91982717 CAGGGCCAGGGGCTGTGTTAGGG - Intergenic
937061733 2:118985060-118985082 CTGGGCCAGGCACTGTGCCTGGG + Intronic
937127179 2:119482221-119482243 CCGGGCCAGGGCCTGGGTTAGGG + Intronic
937149282 2:119674726-119674748 CAGAGCCAGGGCCTGTGTGTGGG + Intergenic
937304058 2:120860406-120860428 CAGCCCCAGGGCCTGTGTTGGGG - Intronic
938220121 2:129559247-129559269 CAGGCCCAGTGTCTGTGTTGTGG + Intergenic
938571594 2:132566789-132566811 AATGGCCAGGGAATGTGTATTGG - Intronic
938964900 2:136379748-136379770 CTGCTCCAGGGACTGTGTTTTGG + Intergenic
940424793 2:153518123-153518145 AAGGGCCAGGGTGTGTGTATTGG - Intergenic
940902792 2:159141539-159141561 GAGGAGCAGGGACTGTGTTTTGG + Intronic
941520304 2:166534073-166534095 CAGAGCCAGAGTCAGTGTTTCGG + Intergenic
942391721 2:175502230-175502252 CAGGTCCAGAGACTCTGTTTGGG + Intergenic
942911030 2:181244784-181244806 CAGGGCCAGGGGCGGGGGTTGGG - Intergenic
944581523 2:201136973-201136995 CAGGGCCAGGGACTGGGGAGTGG + Intronic
945252475 2:207776118-207776140 GAGGGACAGGAAATGTGTTTTGG + Intergenic
947329846 2:229016849-229016871 CTGGGCCAGGCACTGTATTAAGG - Intronic
947947264 2:234116071-234116093 TAGACCCAGGGATTGTGTTTGGG + Intergenic
948122589 2:235542298-235542320 CAGGGCCAGGGACTTGGCCTTGG + Intronic
949031494 2:241799362-241799384 CAGGGGCCGGGTCTGGGTTTGGG + Intronic
1171431588 20:25086242-25086264 CAGAGCCAGGGACAGGGTCTGGG - Intergenic
1172768026 20:37361433-37361455 CGGGGCCAGGGGGTGGGTTTGGG + Intronic
1172869757 20:38128821-38128843 CCGGGGCAGGGGCTATGTTTGGG + Exonic
1173656670 20:44704439-44704461 CAGGCCCAAGGACAGTGGTTTGG - Intergenic
1173809022 20:45945112-45945134 CAAGGCCAGGGACTGGTTTGGGG + Intronic
1174671394 20:52311092-52311114 CAGGGCCAGGGCCAGTGGTTGGG + Intergenic
1175391762 20:58631933-58631955 TAGGGCCAGAGAGTGTCTTTAGG - Intergenic
1176307677 21:5132676-5132698 CAGGGGCAGAGCCTGAGTTTGGG - Intronic
1176592055 21:8656543-8656565 CAGGACCAGGGGCTGCGTTAGGG - Intergenic
1176857982 21:13986344-13986366 CAGGTCCAGGGTCTGCGTTAGGG - Intergenic
1179464340 21:41561828-41561850 GAGGGCCAGGGACTCAGCTTTGG + Intergenic
1179849383 21:44129354-44129376 CAGGGGCAGAGCCTGAGTTTGGG + Intronic
1179910037 21:44442692-44442714 CAGGGCCAGGGGCTGTGTGACGG + Exonic
1180274905 22:10633672-10633694 CAGGACCAGGGGCTGCGTTAGGG - Intergenic
1180549376 22:16528599-16528621 CAGGGCCAGGGGCTGCGTTAGGG - Intergenic
1181355316 22:22293237-22293259 CACGGCCAGGGGCTGCGTTAGGG + Intergenic
1181534732 22:23535444-23535466 CAGGGACAGGGACGGTGCTCAGG - Intergenic
1181729480 22:24834169-24834191 GAGGGCCAGCCACTGTGTATGGG + Intronic
1182116936 22:27761973-27761995 CAGGGCCAGGGACAGTCCCTAGG - Intronic
1183327239 22:37200881-37200903 CTGGACTAGGAACTGTGTTTTGG + Intergenic
1183360883 22:37382829-37382851 CAGGGCCAGGTACGGTGGCTGGG - Intronic
1183509826 22:38228183-38228205 CAGGGCCAGGGACGTTCTGTGGG - Intronic
1183522248 22:38302389-38302411 CAGGGCCTGGGACTCTGCCTGGG - Intronic
1183607611 22:38875160-38875182 CAGAGCCTGAGAGTGTGTTTTGG + Intergenic
1184008906 22:41732012-41732034 AAGTGCCAGGGACTGTGCTATGG + Intronic
1184148508 22:42625062-42625084 CAGGGACAGGGACAGGCTTTGGG + Intronic
1184523664 22:45009451-45009473 CGGGGCCGGGGAGTGTGTTGCGG - Intronic
1185050064 22:48549676-48549698 CAGGGCCAGGGCCAGGCTTTGGG + Intronic
1185137623 22:49081577-49081599 CAGGGGCTGGGACTGTGTGGGGG + Intergenic
1185301061 22:50081497-50081519 CAGGGCCAGGGAGGGAGGTTGGG + Intronic
950563529 3:13749820-13749842 CACGGCCAGGCACTGTGCTGTGG + Intergenic
951634397 3:24757061-24757083 TAGGGCTAGGGAGTGTGGTTTGG + Intergenic
954089497 3:48273103-48273125 CAGAGATAGGGACTGTGTTAAGG + Intronic
954194978 3:48990939-48990961 AAGGGCCAGGGGCTGCGGTTTGG + Intronic
955350939 3:58192405-58192427 CAGGGCCAGTGACAGTGGATGGG + Intronic
956481139 3:69675058-69675080 CTGGGGCAGGGACTTTGTCTTGG + Intergenic
956765276 3:72479561-72479583 CAGGGCTGGGAACTGTGTTGTGG - Intergenic
961038158 3:123657530-123657552 CAGGACCAGGGACTTTGGATTGG - Intronic
961484317 3:127206716-127206738 CAGGGCCAGGGACAGGGGTAGGG + Intergenic
961645598 3:128391217-128391239 GAGGGCAAGGAACTGTGGTTTGG - Intronic
961646112 3:128393641-128393663 CAGAGGCACAGACTGTGTTTTGG + Intronic
962204081 3:133420946-133420968 CAGGGCCAGGGCCTCTCTTGTGG - Intronic
962332020 3:134486409-134486431 CAGGCCGAGGGACTGGGCTTCGG - Intronic
962372005 3:134828562-134828584 CAGGGTCAGGCAGTGAGTTTGGG + Intronic
964454309 3:156844528-156844550 CAGGGCCATGGACTGGGAGTAGG - Intronic
968611409 4:1558844-1558866 CAGGGCCAAGCACTGGGTTCAGG - Intergenic
968979788 4:3840964-3840986 CAGGACCAGGGACTGGGGTGGGG + Intergenic
969429306 4:7144980-7145002 TGGGACCAGGGACTGTGTTGGGG - Intergenic
969482363 4:7453520-7453542 TAGGGTCAGGCACTGTGTTGGGG + Intronic
969482424 4:7453822-7453844 TGGGGCCAGGCACTGTGTTGGGG + Intronic
969482468 4:7454034-7454056 TGGGGCCAGGCACTGTGTTGGGG + Intronic
969482781 4:7455548-7455570 TAGGGTCAGGCACTGTGTTGGGG + Intronic
969495604 4:7524459-7524481 CAGGGCCAGGGCGTGAGTTGAGG - Intronic
970314221 4:14814055-14814077 CAAGGTGAGGGGCTGTGTTTTGG - Intergenic
970314357 4:14815240-14815262 CAAGGCTAGGGGCTGTGTTTTGG + Intergenic
971342351 4:25782129-25782151 CGAGGACAGGGACTGTGTCTGGG + Intronic
971361269 4:25940668-25940690 CAGAGCCAGGATCTGTGCTTGGG - Intergenic
971417078 4:26441747-26441769 CAGGGGATGGGACTTTGTTTTGG - Intergenic
973194493 4:47424189-47424211 AAAGGCCAGGGACTGTGATGTGG + Intronic
974841774 4:67307399-67307421 CAGGGGCAGGGACAATGATTGGG + Intergenic
975730472 4:77332940-77332962 CAGGGATAGAGACTGTGTTAGGG - Intronic
976497359 4:85745914-85745936 CAGGGGAAGGCACTGGGTTTTGG - Intronic
981008147 4:139896854-139896876 CAGGGAAAGGGGCAGTGTTTTGG + Intronic
982230825 4:153206692-153206714 CAGGGTCAGGGGGTGTGTATGGG + Intronic
983977426 4:173952572-173952594 CAGGTATAGGGACTGTGATTAGG - Intergenic
985986232 5:3518819-3518841 CAGGGCCAAGCACGGGGTTTGGG + Intergenic
986160888 5:5227287-5227309 CAGGCGTAGGGACTGTGTTGCGG + Intronic
990851163 5:60206112-60206134 AAGTGCCAGTGAATGTGTTTTGG - Intronic
991173115 5:63652088-63652110 CAGAGCCAAGGACTCTGATTTGG + Intergenic
991216485 5:64161791-64161813 CAGGAACAGGGTCTGTGTTAGGG + Intergenic
991920634 5:71653237-71653259 CACTGCCAGGGTCTGTGTGTCGG + Intronic
992187439 5:74257704-74257726 CAGGGCGGGGGACTGAGTGTGGG + Intergenic
992952972 5:81878785-81878807 GAGGGCAAGGGACTGTGGTTTGG + Intergenic
994267656 5:97737757-97737779 CAAGGCCAGGACCTGTGTTGGGG + Intergenic
994632480 5:102302978-102303000 TAGGGCAAGGGACTAAGTTTTGG - Intergenic
995700727 5:114932135-114932157 CAGTCCCAGGAACTGTGTTTTGG + Intergenic
996836686 5:127801437-127801459 GAGGGGCAGGGACTATGCTTTGG - Intergenic
997193919 5:131965020-131965042 CTGGCCCAGGGACTCTGCTTAGG - Intronic
997434855 5:133866806-133866828 CAGGGCCAGGGGCTGCCTTATGG - Intergenic
997929947 5:138064292-138064314 CCAGGCCAGGCACTGTGTTGAGG + Intergenic
998142357 5:139707350-139707372 CAGGGCCAGGCACTTTGCTCTGG - Intergenic
999177371 5:149640798-149640820 CAGTGCAAGGGACTTTGTATTGG + Intergenic
999791292 5:154941593-154941615 CATGGGCAGGGACCGTGTTGTGG + Intronic
1001412728 5:171522261-171522283 CAGGCACAAGGACTGTGTCTGGG + Intergenic
1001434990 5:171693360-171693382 CAGGGCTCAGGCCTGTGTTTAGG - Intergenic
1001601002 5:172928349-172928371 CAGTGCCAGGGACTGAGCTTGGG - Intronic
1003323872 6:5077129-5077151 CTGAGCCAGGGGCTGTGTGTGGG + Intergenic
1005849801 6:29813030-29813052 CAGGGCCAGGGCCTCTCTTTGGG - Intergenic
1005854817 6:29852820-29852842 CAGGGCCAGAGCCTCTCTTTGGG - Intergenic
1006322748 6:33329940-33329962 CAGGGCAAGGGTATGTGATTGGG + Intergenic
1006791091 6:36701772-36701794 CAGGGCCAGGGACTCTGCTGGGG + Intronic
1007448983 6:41928883-41928905 CAATGCCAGGCACTGAGTTTGGG - Intronic
1007578737 6:42942601-42942623 CTGGGCCAGGGCCTGGGATTGGG - Intergenic
1007709036 6:43810055-43810077 CTGGATCAGGCACTGTGTTTAGG - Intergenic
1008048380 6:46874699-46874721 CAGGGGCTGGGGCTGTGTTGAGG + Intronic
1008355718 6:50550571-50550593 CTCTGCCAGGGACTGTGTTTGGG - Intergenic
1008447988 6:51615926-51615948 GGGGGGCAGGGACTGTGTTCAGG - Exonic
1010447906 6:75969147-75969169 CAGGGGGAGGGGCTGTGGTTTGG + Intronic
1010793092 6:80087603-80087625 TAAGGGCAGGGGCTGTGTTTTGG + Intergenic
1013196117 6:107846719-107846741 CAGGGCCAGGCAGTGTTATTAGG + Intergenic
1013357621 6:109360433-109360455 CAGGGACAGAGGCTGTGTGTGGG + Intergenic
1017245691 6:152222155-152222177 CAGGGATAGGGACTGCGTTAGGG + Intronic
1019058593 6:169240285-169240307 AAGGGCCAGGAACCGTATTTAGG - Intronic
1019081070 6:169430077-169430099 CAGGGCATGGGGCTGTGTCTTGG + Intergenic
1019149922 6:169998462-169998484 CAGGGCCTTGTACTGTGTTGGGG + Intergenic
1019573555 7:1725206-1725228 AGGGGCCAGGCACTGTCTTTAGG + Intronic
1019835323 7:3377703-3377725 CAGGGCAGGGGGCTGTGTGTGGG + Intronic
1020144328 7:5631175-5631197 CAGAGCAAGGGGCTGTGTTTTGG + Intronic
1023437273 7:40151572-40151594 CAGAGCCTGGGACAGTGTTAGGG + Intronic
1024409450 7:49023363-49023385 AAGTGCCAGGGAAAGTGTTTTGG - Intergenic
1025260117 7:57413064-57413086 CAGGGCCAGGGCCTGTCCTATGG + Intergenic
1026732548 7:72924566-72924588 TAGGGCTAGGGAGTGGGTTTGGG - Intronic
1029442158 7:100592878-100592900 CCGGGCCTGTGACTGTGTTGAGG + Exonic
1029448796 7:100629223-100629245 CAGGGCCAGGGCCTGGGCCTGGG - Intronic
1029611992 7:101631333-101631355 CAGGGCCAGGGCCAGTTCTTGGG + Intergenic
1031369164 7:120943180-120943202 CAAGAACAGGGACTGTGTCTTGG + Intergenic
1034340055 7:150347067-150347089 CAGGGCCAGGGAGGGTGCTGTGG + Intergenic
1034385219 7:150735418-150735440 AGAGGCCAGGGACTGTCTTTAGG - Intronic
1038828796 8:31034072-31034094 CAGGCCCCTGGGCTGTGTTTGGG + Intronic
1039557322 8:38485806-38485828 CAGTGGCAGGGGCTGTGTTGTGG - Intergenic
1039633054 8:39133831-39133853 CAGGCTCAAGGACTGCGTTTGGG + Intronic
1044608740 8:94071431-94071453 AAGGGCCAGGCACTGTGCTAAGG + Intergenic
1045506100 8:102779828-102779850 CTGTGGCAGGGACTGTCTTTCGG - Intergenic
1045680533 8:104654946-104654968 CATGGACAGGAACTCTGTTTCGG - Intronic
1047408026 8:124601457-124601479 CAGGGCTCGGGACTGTGTCATGG + Intronic
1047443583 8:124900318-124900340 CAGGGGGAGGGACAGTGATTGGG - Intergenic
1047444467 8:124906998-124907020 CAGGGGGAGGGACAGTGATTGGG - Intergenic
1048889828 8:138937052-138937074 CATGGCCAGGCAGTGTGGTTGGG - Intergenic
1051473817 9:17480999-17481021 CAGGGCCAGAGGCTGTGCTCTGG - Intronic
1053691426 9:40589199-40589221 CAGGGCCAGGGGCTGCATTAGGG - Intergenic
1054273377 9:63048286-63048308 CAGGGCCAGGGGCTGCATTAGGG + Intergenic
1054302684 9:63390165-63390187 CAGGGCCAGGGGCTGCATTAGGG - Intergenic
1054401458 9:64716670-64716692 CAGGGCCAGGGGCTGCATTAGGG - Intergenic
1054435066 9:65200990-65201012 CAGGGCCAGGGGCTGCATTAGGG - Intergenic
1054495324 9:65820691-65820713 CAGGGCCAGGGGCTGCATTAGGG + Intergenic
1056599757 9:88037565-88037587 CAGAGGTAGGGACTGTGTTAGGG - Intergenic
1056763070 9:89428324-89428346 CAGGGCCAGGGACTGTGTTTGGG - Intronic
1058571559 9:106351008-106351030 CAAAGCCAGTGACTGTGTCTAGG + Intergenic
1059332240 9:113542886-113542908 GAGGGCCAGGGACTGGGCTGGGG + Intronic
1059362384 9:113754943-113754965 GAGGGGAAGGCACTGTGTTTGGG + Intergenic
1059455504 9:114398028-114398050 CGGGGCCTCGGGCTGTGTTTGGG - Intergenic
1059486697 9:114632756-114632778 CAGGGCCTGGGACTCTGTCAAGG - Intronic
1060332431 9:122685721-122685743 CAGGGCTAGGGTCTGAGTGTGGG - Intergenic
1060510457 9:124228553-124228575 CAAGGCCAGGGCCTGTGTCCTGG - Intergenic
1061245684 9:129400393-129400415 CAGGGACAGGGACGGTGCTCAGG + Intergenic
1061309549 9:129753220-129753242 CAGAGCCAGGGACTGGGTCCGGG - Intergenic
1061394563 9:130337001-130337023 CAGGGCCAGCGACTGGGCCTTGG + Intronic
1061446387 9:130640556-130640578 CAGGCCCTGGGTCTGTGTCTTGG + Intergenic
1061674586 9:132208529-132208551 CAGGGACAGGGGCTGTGATGTGG + Intronic
1062289940 9:135789947-135789969 CAGTGCCAGGGCCTGGGTTGTGG - Intronic
1062309706 9:135929236-135929258 CAGGGCCAGGGCCTGCGGTTGGG - Intergenic
1062349527 9:136132278-136132300 CAGGGCTAGGGTCTGTGTTTTGG + Intergenic
1062437246 9:136551789-136551811 CGGGGCAAAGGACTGTGCTTTGG - Intergenic
1062481623 9:136755068-136755090 CAGGGCCAGGGACTGGGCCAGGG + Intronic
1062496014 9:136832027-136832049 CAGGGCCGGGAACTGTGTGCTGG + Intronic
1062588904 9:137264160-137264182 CAGGGCCTGGAGCTGTGTTTGGG + Intronic
1062598447 9:137309574-137309596 CAGGGTCAGGCACTGGGTCTGGG - Intronic
1203622106 Un_KI270749v1:135390-135412 CAGGACCAGGGGCTGCGTTAGGG - Intergenic
1185460432 X:330762-330784 CGGGGCAAGGGCCTGTGTGTTGG + Intergenic
1190445209 X:50517055-50517077 CAAAACCAGGGACTGTGTCTTGG + Intergenic
1190484643 X:50912346-50912368 GAGTGCCAGGCAGTGTGTTTGGG + Intronic
1192273898 X:69610759-69610781 CAGGGCCAGGGACTTAGTGAAGG + Intergenic
1192427828 X:71093040-71093062 GAGGGGCAGGGACTGTAATTTGG - Intergenic
1193257598 X:79367699-79367721 CAGGGCCTGGGACTGTAGCTTGG + Intergenic
1194179770 X:90697339-90697361 CAGGGTCAGTCACTGTGTATGGG - Intergenic
1195095120 X:101494111-101494133 CTGGGCCTGGGACTGAGTCTGGG + Exonic
1196491028 X:116267065-116267087 AAGGGCCAGGTTCTGTGTTTTGG + Intergenic
1196993607 X:121356447-121356469 CAGGGGGAGGGACAGTGATTGGG + Intergenic
1198490951 X:137141027-137141049 CAGGGCCAGGGACTGGGGAGAGG - Intergenic
1199710164 X:150463291-150463313 CAGAACCTGGGAATGTGTTTGGG + Intronic
1200324031 X:155218657-155218679 AAGTGCCAGGGATTTTGTTTTGG - Intronic
1201190117 Y:11437871-11437893 CAGGGCCAGGGGCTGTGTTAGGG - Intergenic
1201962306 Y:19694888-19694910 CAGGGGGAGGGACAGTGATTGGG - Intergenic
1202087223 Y:21151727-21151749 CAGGGACAGGAACTGTATTACGG - Intergenic
1202583510 Y:26404056-26404078 CAGGGCCAGGGGCTGTGTTAGGG + Intergenic