ID: 1056764498

View in Genome Browser
Species Human (GRCh38)
Location 9:89436530-89436552
Sequence CACCCTTCAGCGCAGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056764494_1056764498 -8 Left 1056764494 9:89436515-89436537 CCAGCCACAACAAGGCACCCTTC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1056764498 9:89436530-89436552 CACCCTTCAGCGCAGGGACAAGG 0: 1
1: 0
2: 0
3: 14
4: 140
1056764492_1056764498 3 Left 1056764492 9:89436504-89436526 CCAGGACTGCTCCAGCCACAACA 0: 1
1: 0
2: 3
3: 22
4: 234
Right 1056764498 9:89436530-89436552 CACCCTTCAGCGCAGGGACAAGG 0: 1
1: 0
2: 0
3: 14
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056764498 Original CRISPR CACCCTTCAGCGCAGGGACA AGG Intronic
900479021 1:2889413-2889435 CAGTCCTCAGGGCAGGGACAGGG - Intergenic
900566705 1:3335861-3335883 CACACTTCAGTGCAGGAGCATGG - Intronic
901834771 1:11916974-11916996 CACCCTTCACCCGTGGGACATGG - Intergenic
904926252 1:34050578-34050600 TACCTTGCAGCGCTGGGACAAGG + Intronic
905649426 1:39646594-39646616 AACTCTGCAGCCCAGGGACAGGG - Intergenic
912662154 1:111541746-111541768 CAACATTCAGTGGAGGGACAGGG + Intronic
913256688 1:116960517-116960539 CACCCTTCTCTGCAGGGACATGG + Intronic
915084260 1:153374401-153374423 CTCCCCTCAGTGCAGGGTCATGG + Intronic
919751813 1:201042495-201042517 CCCCCTTCAGGGCAGGGCCCAGG + Intronic
1066044453 10:31583576-31583598 CACCCTGCAGAGCCAGGACAGGG - Intergenic
1068698970 10:60000051-60000073 CACCATTCACAGCAGGAACAGGG - Intergenic
1069297247 10:66861494-66861516 CACCCAGCAGCTCAGGCACAAGG - Intronic
1069749380 10:70735769-70735791 CATCCTGCAGGGTAGGGACAAGG - Intronic
1072617992 10:97062565-97062587 CACCCTGCAGGGCAGGGCCCAGG - Intronic
1076590106 10:131577015-131577037 CACCGCTCAGCGCAGGGCCTGGG - Intergenic
1076671426 10:132122825-132122847 CAACCTTCTGGGCAGGGAGAGGG - Intronic
1077233369 11:1468547-1468569 CACCATGCAGCCCAGGGTCACGG + Intergenic
1083470693 11:62881807-62881829 CACCCTTAGGCGCTGGGAGAAGG + Intronic
1083676670 11:64329727-64329749 AACAATTCAGGGCAGGGACAGGG + Intergenic
1083734290 11:64670805-64670827 CCTGCTTCAGCGCAGGGAAAGGG + Intronic
1084287718 11:68142624-68142646 CACTCCACAGGGCAGGGACAGGG + Intergenic
1084317813 11:68355428-68355450 CACCCTTCACAGCAGAGAAAGGG - Intronic
1084451522 11:69241625-69241647 CATCCTTCAGCGTAGGGGCAGGG - Intergenic
1084704329 11:70807008-70807030 CCCCCTTCACCGCGGTGACAGGG - Intronic
1084945053 11:72633913-72633935 CTCCCTTCAGCGCTGGGTCATGG - Intronic
1091903957 12:4167880-4167902 CAGCCTTCTGCTCAGGGACATGG + Intergenic
1101476256 12:105051393-105051415 CACACTGCAGTGGAGGGACATGG - Intronic
1102498168 12:113333667-113333689 CACCCTGCACAGCAGGGAGAGGG + Intronic
1103561269 12:121794302-121794324 CACCCTGCAGCCCAGGGTCGGGG - Intronic
1103624471 12:122207372-122207394 CACCCTTCAGCGCTGGGGTATGG - Exonic
1107029256 13:35834121-35834143 CACCCCACAGCTCAGGGGCATGG + Intronic
1109825031 13:67707842-67707864 CACACATCAGCGGAGGGACCCGG + Intergenic
1112143115 13:96668500-96668522 CTCCCTTCTGCTGAGGGACAAGG + Intronic
1113827469 13:113267923-113267945 CACCCTCCAGCCTAGGGCCATGG - Intergenic
1115566351 14:34628912-34628934 CACCCTTCAGCCAAGGAAAAAGG + Intronic
1115730230 14:36260474-36260496 CCCCCTGCAGCTCAGAGACATGG + Intergenic
1118081034 14:62361280-62361302 CTCCCTTCTGCACAGAGACATGG - Intergenic
1118224417 14:63885437-63885459 CATCCTTCAGAGAAGGGAAATGG - Intronic
1118702918 14:68451741-68451763 CACCCATCAGAGCAGGGCCAGGG + Intronic
1122599756 14:102915406-102915428 CTCCATACAGCGCAGGGGCAGGG + Intergenic
1122981703 14:105195125-105195147 CACCCTCCAGCTCACGGGCACGG - Intergenic
1122981795 14:105195375-105195397 CACCCTCCAGCTCACGGGCACGG - Intergenic
1125713711 15:41806755-41806777 CACCCTGCTGGGCAGGGTCAGGG + Intronic
1125735255 15:41920355-41920377 CACTCTTCAGCCCAAGGTCAAGG + Intronic
1128306564 15:66602943-66602965 CACCAGTCAACGCAGGGAGAAGG + Intronic
1128339169 15:66808465-66808487 CACCCCTCAGGGCAGCGACGTGG - Intergenic
1129686550 15:77689370-77689392 TACCCTTTAGCGCAGGGAGGCGG - Intronic
1129780004 15:78264150-78264172 CACCCTTCGGCGCAGGGCTCCGG + Exonic
1130074167 15:80674454-80674476 CAACCTCCAGGGAAGGGACAGGG + Intergenic
1132974072 16:2702859-2702881 CATCCCTGAGTGCAGGGACATGG + Intronic
1133282786 16:4676609-4676631 CTGCCGTCAGCCCAGGGACAGGG - Intronic
1136554206 16:30998106-30998128 CACCTTACAGGGCAGGGAGAGGG - Intronic
1138353948 16:56362957-56362979 CATCCTTCGACGCAGGGTCACGG + Exonic
1141618808 16:85225549-85225571 TACCCGGCAGCGGAGGGACAGGG - Intergenic
1142598050 17:1039195-1039217 CACCCTTCAGAGGCGGGTCAGGG + Intronic
1143121549 17:4610806-4610828 CAGCCTTCACTGGAGGGACAAGG + Intergenic
1143955094 17:10661880-10661902 CACCCTTCACCTCAGTGCCAGGG - Intergenic
1146546971 17:33748345-33748367 CATCCTTCAGTGCAGGGGCTTGG + Intronic
1148440679 17:47710310-47710332 CACCCCCCTGCCCAGGGACAGGG - Intronic
1148986039 17:51622204-51622226 AACCCTTCAGCCCTGTGACAAGG - Intergenic
1149595178 17:57861110-57861132 CGCCCTCCACCACAGGGACAGGG - Intergenic
1150782324 17:68133880-68133902 CAGCTTGCAGCCCAGGGACAGGG - Intergenic
1151579207 17:74968639-74968661 CTCCCTGGAGCGCAGGGACATGG + Intronic
1151658809 17:75508064-75508086 CTCCCTCCAGCCCAGGGACAGGG + Intronic
1152097714 17:78281537-78281559 CACCCTGCAGCCCAGGGGAAGGG + Intergenic
1152130737 17:78474873-78474895 CACCCTTCACCTCAGTCACATGG + Intronic
1152451660 17:80385294-80385316 CACCCTTCACCGCATGGTAAGGG - Intronic
1154192978 18:12245793-12245815 CTCCCTTCAGCTCATGGAAATGG - Intergenic
1155205941 18:23557852-23557874 CTCCTTGCAGGGCAGGGACAGGG + Intronic
1156233518 18:35179041-35179063 CACAGTTCTGCCCAGGGACAGGG - Intergenic
1157620715 18:49016135-49016157 CTCCCTTAAGAGCAGGAACAAGG - Intergenic
1157668754 18:49510898-49510920 CACCCTGGGGAGCAGGGACAGGG - Intergenic
1158530439 18:58255919-58255941 CTCCCTGCAGCGCAAGGCCACGG + Intronic
1159057623 18:63481874-63481896 CTCCCCTCAGGGCAGGGGCAAGG - Intronic
1160840630 19:1145655-1145677 CACCCTTCAGGGGACGCACAGGG - Intronic
1162127841 19:8508878-8508900 CACTCCTCAGAGCTGGGACATGG + Intergenic
1163289922 19:16372672-16372694 CACCCTGCGGCACAGGGACCGGG - Intronic
1165258852 19:34596635-34596657 GACCCAGCAGGGCAGGGACAGGG + Intronic
1168179866 19:54654611-54654633 CAGCCTCCAGGGCAGAGACAAGG - Intronic
925904200 2:8529559-8529581 CCCCCTTCAGCTCAGGTATACGG + Intergenic
927502290 2:23590881-23590903 CTCACTTCAGCACAGGCACACGG - Intronic
928678155 2:33670802-33670824 CACCTGGCAGGGCAGGGACAAGG - Intergenic
931252049 2:60540736-60540758 CAACCTTCAGCTCAGGGAGGAGG - Intronic
932126326 2:69148342-69148364 CACTCTGCAGAGCAGGGCCAAGG - Intronic
932158058 2:69436441-69436463 GTCCCTTCAGCCCAGGGAAAAGG + Intronic
937980012 2:127609291-127609313 CACCCTGCCGGGCAGGGGCAGGG - Intronic
940245580 2:151611925-151611947 CACCCTTCTGAGCAGTGACCTGG - Intronic
945803487 2:214462319-214462341 CACTTTCCAGTGCAGGGACAGGG - Intronic
946339132 2:219057198-219057220 CACCCAGCAGCCCTGGGACAGGG + Intronic
946759856 2:222982762-222982784 CACCCTTAAGAGGAGGGGCAAGG - Intergenic
948320226 2:237062895-237062917 AAACCTTCAGCCAAGGGACATGG - Intergenic
948421662 2:237863967-237863989 CACCCACCACCCCAGGGACAGGG + Intronic
948613440 2:239184254-239184276 CAGCCTCCAGGGCAGGTACAGGG - Intronic
948750113 2:240127278-240127300 CACCTTACAGCTCAGGCACAGGG + Intronic
1172479648 20:35263605-35263627 CTCTCTGCAGAGCAGGGACAAGG - Intronic
1174419636 20:50391158-50391180 CACCCAGCAGAGCAGGCACAAGG + Intergenic
1176113735 20:63422215-63422237 CACCCAGCAGCCCAGGGACGTGG + Intronic
1181493075 22:23272940-23272962 CTCCCCTCTGCGCAGTGACAAGG - Intronic
1181687096 22:24536910-24536932 CACCCTTTAGAGCAGGGCCCAGG - Intergenic
1182486794 22:30643937-30643959 CTCCCTGCAGCCCAGGGAAAGGG - Intronic
1183581272 22:38728011-38728033 CACCATTCTGAGCATGGACAAGG + Exonic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
1185323976 22:50216630-50216652 CTGCCTGCAGGGCAGGGACACGG + Intronic
949969902 3:9396406-9396428 CACCCTTCTGGGCAGGGGGAGGG - Intergenic
952906322 3:38141270-38141292 CAGTCTTCAGGGCAGGGACAAGG - Exonic
953462792 3:43095055-43095077 CACCCTGCTGAGCAGGGGCAAGG - Intronic
953772982 3:45792900-45792922 CACACTTCAGGGAAGGGTCAGGG - Intronic
960625455 3:119677504-119677526 CCCCCTTCAGCGCATGCGCAAGG + Intergenic
961336662 3:126184433-126184455 CACCTCTGAGGGCAGGGACAGGG + Intronic
962143230 3:132812554-132812576 TGCCCTTCAGCCTAGGGACAGGG - Intergenic
962928434 3:140015983-140016005 CACTCTTCAGGGCAGTGACATGG - Intronic
964883712 3:161454776-161454798 CAGGCTTCAGCACAGGGAAAGGG + Intergenic
965514729 3:169608599-169608621 TTCCCTTCAGGGCAGGCACACGG + Intronic
967335223 3:188336944-188336966 CACCCTTCATCCCAGGGAAATGG - Intronic
968487779 4:872237-872259 CACCCCTCAGGGCGGGCACAGGG - Intronic
968554618 4:1240652-1240674 CACCGTTCAGCTGAGGGACCCGG - Intronic
968830929 4:2932752-2932774 CACCCATCTGCCCAGGGGCAGGG + Exonic
986030631 5:3889754-3889776 TTCCCTTTAGTGCAGGGACAAGG - Intergenic
991596929 5:68315799-68315821 CTCCCTTCAAAGCAGGCACAGGG + Intergenic
993042463 5:82830564-82830586 CAGCCTCCAGAGCAGGGACCTGG - Intergenic
997885696 5:137628056-137628078 CACCCTTCACTGCGGGGAAAGGG + Intronic
998148016 5:139741211-139741233 GCCCCTTCAGGTCAGGGACATGG + Intergenic
1002925728 6:1604861-1604883 CACCTCTCAGGACAGGGACAAGG - Intergenic
1006984860 6:38169516-38169538 CAGCCTTCAGGGCAGGGACTGGG - Exonic
1007368282 6:41409439-41409461 CACCCTTGCTCGCAGGGAAAGGG - Intergenic
1007403932 6:41622461-41622483 CAGGCTTCAGTACAGGGACAGGG - Intergenic
1008150830 6:47949438-47949460 CAGCCTTCAGGGCAGGGACCAGG - Intronic
1016990250 6:149923486-149923508 CACTCTGCAACGCAGGGAGAGGG - Intergenic
1017128740 6:151090299-151090321 GCCCCTTCAGCACAGGGAAAGGG - Intronic
1019738361 7:2661239-2661261 CACCCTCCAGGGCCGGGCCAAGG - Intronic
1024359748 7:48455539-48455561 CGCCCTTTCGCGCAGGGACTCGG - Intronic
1026841204 7:73670894-73670916 CACCCCTCAGCTGGGGGACAGGG - Intronic
1029475950 7:100784721-100784743 CAGCCCTCAGCGCAGGCAGAGGG - Exonic
1032264901 7:130363889-130363911 CTCCCTTCAGGGCAGGGCTAGGG - Intronic
1032517638 7:132518860-132518882 CACCCTCCAGGCCAAGGACAAGG - Intronic
1034033319 7:147791855-147791877 CAGGCTTCAGCGAAAGGACACGG + Intronic
1034047646 7:147946958-147946980 TACCCTTCTTCACAGGGACAGGG + Intronic
1037656252 8:20886806-20886828 CTCTCTTCAGGGCTGGGACATGG - Intergenic
1038666266 8:29540667-29540689 CTCCCTTCAGAGCAGAGAAAGGG - Intergenic
1042502024 8:69519233-69519255 GACCCTTCAAGGCAGTGACAGGG + Intronic
1043688503 8:83119572-83119594 CACCATTTAGCACAGTGACAGGG + Intergenic
1049685398 8:143937374-143937396 CACCCTCCCCCGCAGGGAAAGGG + Intronic
1056764498 9:89436530-89436552 CACCCTTCAGCGCAGGGACAAGG + Intronic
1060814439 9:126627214-126627236 CTGCCTGCAGGGCAGGGACAGGG - Intronic
1061273169 9:129555387-129555409 GACCATTCACTGCAGGGACAGGG + Intergenic
1061445539 9:130635254-130635276 CAGCCTTCAGAGCAGGGCGAGGG + Intronic
1062396403 9:136354618-136354640 CACCCTTCAGCCCTGGGGCCCGG + Intronic
1190635978 X:52434309-52434331 CAACCTTCAGGGAAGGGACAAGG + Intergenic
1190638808 X:52463311-52463333 CAACCTTCAGGACAGGGAGAGGG + Intergenic
1190653356 X:52589614-52589636 CAACATTCAGGGCAGGGAGAGGG + Intergenic
1190680053 X:52818887-52818909 CAACCTTCAGGACAGGGAGAGGG + Intergenic
1192047847 X:67695292-67695314 CTACCTTCAGCTCAGTGACAGGG - Intronic
1192560950 X:72127563-72127585 CACACTTCTCCACAGGGACATGG + Intronic
1199223466 X:145343833-145343855 CACCCTTGAGAGCAGCCACAGGG - Intergenic
1201385466 Y:13435860-13435882 CAACTTTCAGCGCAGTGAAAAGG + Intronic