ID: 1056764693

View in Genome Browser
Species Human (GRCh38)
Location 9:89437508-89437530
Sequence CCTGTCGCTGCCGCCTGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 90}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056764693_1056764704 20 Left 1056764693 9:89437508-89437530 CCCTAGCAGGCGGCAGCGACAGG 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1056764704 9:89437551-89437573 GCCCTGAGAGGGGAGGGCACAGG No data
1056764693_1056764707 25 Left 1056764693 9:89437508-89437530 CCCTAGCAGGCGGCAGCGACAGG 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1056764707 9:89437556-89437578 GAGAGGGGAGGGCACAGGCCTGG No data
1056764693_1056764701 10 Left 1056764693 9:89437508-89437530 CCCTAGCAGGCGGCAGCGACAGG 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1056764701 9:89437541-89437563 GCTGCGGTGCGCCCTGAGAGGGG No data
1056764693_1056764699 8 Left 1056764693 9:89437508-89437530 CCCTAGCAGGCGGCAGCGACAGG 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1056764699 9:89437539-89437561 CTGCTGCGGTGCGCCCTGAGAGG No data
1056764693_1056764696 -6 Left 1056764693 9:89437508-89437530 CCCTAGCAGGCGGCAGCGACAGG 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1056764696 9:89437525-89437547 GACAGGCACTCCCACTGCTGCGG No data
1056764693_1056764703 14 Left 1056764693 9:89437508-89437530 CCCTAGCAGGCGGCAGCGACAGG 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1056764703 9:89437545-89437567 CGGTGCGCCCTGAGAGGGGAGGG No data
1056764693_1056764700 9 Left 1056764693 9:89437508-89437530 CCCTAGCAGGCGGCAGCGACAGG 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1056764700 9:89437540-89437562 TGCTGCGGTGCGCCCTGAGAGGG No data
1056764693_1056764702 13 Left 1056764693 9:89437508-89437530 CCCTAGCAGGCGGCAGCGACAGG 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1056764702 9:89437544-89437566 GCGGTGCGCCCTGAGAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056764693 Original CRISPR CCTGTCGCTGCCGCCTGCTA GGG (reversed) Intronic
900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG + Intronic
900251924 1:1675377-1675399 CCCGTCTCTGCTGCCTGCCATGG - Intronic
900262335 1:1738234-1738256 CCCGTCTCTGCTGCCTGCCATGG - Intronic
900401956 1:2476306-2476328 CCTGACGCAGCCGCCTCCCAAGG - Exonic
900947960 1:5841846-5841868 GCTGCCGCTGCCGGCTGCTGAGG - Intergenic
903543256 1:24108462-24108484 CCTGTGGCTCCCACCTGCTGCGG + Exonic
906774066 1:48512742-48512764 CCTGTCACTTCTGCCTGCTATGG - Intergenic
907575857 1:55524977-55524999 CCTGTCTCTGCTGCCTGTTCTGG + Intergenic
909926856 1:81447968-81447990 CCTGTCTCTTCCTCCTGCTCCGG + Intronic
911017142 1:93345773-93345795 CCAGCAGCTTCCGCCTGCTACGG - Intergenic
914912950 1:151801601-151801623 CCTGTGACTGCCGCCTCCTCTGG - Exonic
915556054 1:156661412-156661434 CCTGTCCCTGACACCTGCTGGGG + Intergenic
921363811 1:214355209-214355231 ACTGTCCCTGCCGTATGCTACGG - Exonic
923505188 1:234599805-234599827 GCCGTGGCTGCCGCCTGCAAGGG - Intergenic
1073082082 10:100866737-100866759 CCTGCCGCTGCCGCCCGCCCGGG + Intergenic
1081705678 11:45180922-45180944 CCAGTCGCCGCCGCCGGCTTTGG + Intronic
1084482581 11:69430368-69430390 CCAGGCCCTGCCGCCTCCTATGG + Intergenic
1085340315 11:75727132-75727154 CCTGTCCCTGCTACCTCCTAGGG - Intronic
1089387838 11:118079642-118079664 CCTGACGCTTCCGGCTGCTCTGG + Intronic
1092286364 12:7131082-7131104 CCTTTCACTGGCGCATGCTAAGG + Intronic
1097547644 12:61024046-61024068 CATGTTGCTGCCGCTGGCTAGGG - Intergenic
1101841550 12:108331058-108331080 TCTGTCTCTGCCCCATGCTAGGG - Intronic
1103852509 12:123942340-123942362 CGTGTCGCTGCCGCCTAGCATGG - Intronic
1103954196 12:124567435-124567457 CCTCCCGCCGCCGCCTCCTAGGG + Intronic
1104796846 12:131526132-131526154 CCTGTAGCTGCTGCCTGGCAGGG + Intergenic
1105019152 12:132804923-132804945 CCTGCCGCTGCTGGCTGCTGTGG + Exonic
1107343187 13:39431888-39431910 TCTGTCCCTACCCCCTGCTATGG + Intronic
1108024871 13:46167337-46167359 CCTGGCTCTGTCGCCAGCTAAGG + Intronic
1108479511 13:50854123-50854145 CCTGTCTCTTCCTCCTGCTCCGG + Intergenic
1110868708 13:80425158-80425180 CCTGTCTCTTCCTCCTGCTCTGG - Intergenic
1113857206 13:113453814-113453836 CCTGTCACTGCCGCCCGCTGCGG + Intergenic
1113873912 13:113582997-113583019 CCAGCCTCTGCCGCCTGCTGTGG + Intergenic
1122145894 14:99688685-99688707 CCTGTAGCTGCCGCCCCCTATGG + Intronic
1122818550 14:104327713-104327735 CCTGTCTCTGCGGCTTGCGATGG + Intergenic
1123040187 14:105487224-105487246 CCAGCCGCTGCCGCCTGCACCGG + Exonic
1124371115 15:29105299-29105321 CCTGCCGCAGCCCCCTGCTGAGG + Intronic
1131520903 15:93114151-93114173 CTTCTCGCTCCCGCCTGCTCTGG + Intergenic
1135986049 16:27185129-27185151 CCTGCCGCTTCCTCCTGCTCTGG - Intergenic
1139380603 16:66528217-66528239 CCTGTCCCTGCCGCGAGCTTGGG - Intronic
1141490889 16:84371910-84371932 CCTGTCTCTGCCTCCTGGTTGGG - Intronic
1144334661 17:14257942-14257964 CCTGTCTCTGCTCCCTGCCATGG + Intergenic
1147642636 17:42013640-42013662 CCTATCACTGCCCTCTGCTATGG + Intronic
1150645208 17:66973590-66973612 CCTATTGCTGCCGCACGCTACGG - Intronic
1152235611 17:79136752-79136774 CCTGGCACTGCCGCCTGCCCTGG - Intronic
1153660212 18:7319291-7319313 CCTGTGGCTGCAGCCTTCTAGGG + Intergenic
1153781311 18:8497339-8497361 CCTGTCTCAGCCTCCTGCTGAGG + Intergenic
1163221898 19:15927652-15927674 TCTGTCGCTGCAGCCTGGTCTGG - Intronic
1165258154 19:34592434-34592456 CCTGTCCCTCCCTCCTGCTCAGG - Intergenic
936154733 2:110040464-110040486 CGTGTCTCTGACGCCTGCCAGGG - Intergenic
936189950 2:110330950-110330972 CGTGTCTCTGACGCCTGCCAGGG + Intergenic
937761563 2:125610250-125610272 CCTGTCTCTGCCACCTACTTGGG + Intergenic
941689113 2:168480109-168480131 CCAGTCGCTGCTACCTACTATGG - Intronic
1172314066 20:33939934-33939956 CCTGTCCTTGCCTCCTGCTCCGG - Intergenic
1173744190 20:45424137-45424159 CCTGTCCCTGCTGCTTGCCATGG - Intronic
1176303922 21:5113731-5113753 CCTCCCTCTGCCGCCAGCTATGG - Intergenic
1176457962 21:6929299-6929321 CCTGGCCCTGCTGCCTGCTCAGG + Intergenic
1176836134 21:13794383-13794405 CCTGGCCCTGCTGCCTGCTCAGG + Intergenic
1177876077 21:26633214-26633236 CCTGGCACTGGGGCCTGCTAAGG + Intergenic
1179209497 21:39313392-39313414 CCTGGCGCTCCCGGCTGCTTCGG - Intronic
1179853108 21:44148219-44148241 CCTCCCTCTGCCGCCAGCTATGG + Intergenic
1179897026 21:44368939-44368961 CCGGTCCCTGCCGCCTCCTCAGG - Intronic
1179993051 21:44958562-44958584 CCAGTCGGTGCCGCGGGCTACGG - Intronic
1184523488 22:45008793-45008815 CCTGTGGCTGCCGCCTCATCGGG + Intronic
1184770697 22:46595017-46595039 CCTGTCGTTCCCGCCTCCTGTGG + Intronic
950547547 3:13647557-13647579 TCTGTTGCTGGTGCCTGCTACGG + Intergenic
957919799 3:86732700-86732722 CCTGTTGCTGCTGCTTGCTCAGG + Intergenic
961429037 3:126867336-126867358 CATGTAGCTGCTGCCAGCTATGG - Intronic
967849517 3:194071306-194071328 CCTGGCGCGGCCGCCGGCTGTGG - Intergenic
975989591 4:80243731-80243753 CCTGCTGCTGCCACCTGCTCCGG + Intergenic
981712554 4:147723609-147723631 CCTGTGCCTGCCTCATGCTAGGG - Intergenic
985792186 5:1935274-1935296 CCTGGCGCTGCTGCCTGCTTTGG + Intergenic
998228708 5:140345954-140345976 CCGGTCCCGGCCGCCTCCTAGGG + Exonic
1005372742 6:25152797-25152819 CCTGTCCCTGCTGTCTGATAGGG - Intergenic
1006462276 6:34167996-34168018 CCTGTCGCTTGCCCCTGCTCTGG + Intergenic
1006728081 6:36214365-36214387 CCTGTCTCTTCCTCCTGCTGGGG - Exonic
1011517223 6:88166884-88166906 CAGCTCGCTGCCGCCTGCCACGG - Intergenic
1013450903 6:110279995-110280017 CCTGTCTCTTGCGCCTGCTCTGG - Intronic
1016904669 6:149136949-149136971 ACTGTCCCTGTCCCCTGCTATGG - Intergenic
1018568553 6:165183635-165183657 GCTGTGGCTGCAGCCAGCTAAGG + Intergenic
1019309451 7:353118-353140 CCTCTCTCTGCCCCCTGCTATGG + Intergenic
1019309560 7:353467-353489 CCTCTCTCTGCCCCCTGCTACGG + Intergenic
1019309591 7:353585-353607 CCTCTCTCTGCCCCCTGCTACGG + Intergenic
1019577799 7:1745913-1745935 CCTGGCGCCGCCGCCTGCGCAGG - Exonic
1020013409 7:4818198-4818220 CCTGTCCAGGCCGCCTGCCAGGG + Intronic
1021152471 7:17168117-17168139 TCTGTTTCTGCCTCCTGCTAGGG + Intergenic
1024054467 7:45651088-45651110 CCTGTAGCTGCTGTCTGCTTGGG + Intronic
1034842487 7:154412242-154412264 TCTGTCCCAGCAGCCTGCTATGG - Intronic
1035304647 7:157924029-157924051 CCCATCCCTGCCGTCTGCTATGG - Intronic
1035477857 7:159156317-159156339 CCTGGTGCTCCCGCCTGCTGTGG + Intergenic
1042509555 8:69597224-69597246 CCTGTGGTTGCCCCCTGCTGAGG - Intronic
1049511882 8:143031575-143031597 CCTGTGGCTGTGGCCTGCTTGGG - Intergenic
1049705737 8:144041150-144041172 CCTCTCCCTGCCGCCTGCCTGGG + Intronic
1052396893 9:27949577-27949599 CCTGTGACTGCCGCCTTCTCTGG - Exonic
1053125207 9:35575593-35575615 CTTGGCCCTGCCGCCTGCCAGGG - Intergenic
1056764693 9:89437508-89437530 CCTGTCGCTGCCGCCTGCTAGGG - Intronic
1061248603 9:129413992-129414014 CCTGCCCCTGCCGCCCGCTTAGG + Intergenic
1062393982 9:136345313-136345335 CCTGTCTCTCCCGCCTGCGAGGG - Intronic
1187046756 X:15655011-15655033 CCTGTCACTTCCGGCTGCTAAGG + Intronic
1195627497 X:107019200-107019222 CCCGTCTCTCCTGCCTGCTATGG + Intergenic
1198720330 X:139611217-139611239 CCTGTCACTGGCTCCTGCTGAGG - Intronic
1198963567 X:142205729-142205751 CCTGTCCCTGCTGCCAGCTCTGG - Intergenic