ID: 1056765255

View in Genome Browser
Species Human (GRCh38)
Location 9:89441202-89441224
Sequence AGGTCTGGGAGTTTGGTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056765255_1056765267 26 Left 1056765255 9:89441202-89441224 CCTTAAACCAAACTCCCAGACCT No data
Right 1056765267 9:89441251-89441273 TTCCACACACGCGCAGGACTCGG No data
1056765255_1056765259 -4 Left 1056765255 9:89441202-89441224 CCTTAAACCAAACTCCCAGACCT No data
Right 1056765259 9:89441221-89441243 ACCTTACGAATACCAACCCTTGG No data
1056765255_1056765269 30 Left 1056765255 9:89441202-89441224 CCTTAAACCAAACTCCCAGACCT No data
Right 1056765269 9:89441255-89441277 ACACACGCGCAGGACTCGGCCGG No data
1056765255_1056765265 20 Left 1056765255 9:89441202-89441224 CCTTAAACCAAACTCCCAGACCT No data
Right 1056765265 9:89441245-89441267 CTCCGCTTCCACACACGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056765255 Original CRISPR AGGTCTGGGAGTTTGGTTTA AGG (reversed) Intronic