ID: 1056765256

View in Genome Browser
Species Human (GRCh38)
Location 9:89441209-89441231
Sequence ATTCGTAAGGTCTGGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056765256_1056765271 27 Left 1056765256 9:89441209-89441231 CCAAACTCCCAGACCTTACGAAT 0: 1
1: 0
2: 2
3: 12
4: 186
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data
1056765256_1056765270 24 Left 1056765256 9:89441209-89441231 CCAAACTCCCAGACCTTACGAAT 0: 1
1: 0
2: 2
3: 12
4: 186
Right 1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG No data
1056765256_1056765267 19 Left 1056765256 9:89441209-89441231 CCAAACTCCCAGACCTTACGAAT 0: 1
1: 0
2: 2
3: 12
4: 186
Right 1056765267 9:89441251-89441273 TTCCACACACGCGCAGGACTCGG No data
1056765256_1056765269 23 Left 1056765256 9:89441209-89441231 CCAAACTCCCAGACCTTACGAAT 0: 1
1: 0
2: 2
3: 12
4: 186
Right 1056765269 9:89441255-89441277 ACACACGCGCAGGACTCGGCCGG No data
1056765256_1056765265 13 Left 1056765256 9:89441209-89441231 CCAAACTCCCAGACCTTACGAAT 0: 1
1: 0
2: 2
3: 12
4: 186
Right 1056765265 9:89441245-89441267 CTCCGCTTCCACACACGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056765256 Original CRISPR ATTCGTAAGGTCTGGGAGTT TGG (reversed) Intronic
902123946 1:14192836-14192858 ATTCTTAGGTTCTGGGAGCTAGG - Intergenic
905880498 1:41460240-41460262 ATTCACAAGTTCTGAGAGTTAGG + Intergenic
908838260 1:68250292-68250314 ATTCTTTAGTACTGGGAGTTGGG + Intergenic
909331624 1:74419392-74419414 ATTCACAAAGTCTGGGAATTAGG + Intronic
910004849 1:82383809-82383831 ATTCACAAGTTCTGGGTGTTAGG + Intergenic
914327148 1:146630251-146630273 ATTCATAGGTTCTGGGAATTAGG + Intergenic
914815610 1:151059884-151059906 CTTGGTTAGGTCTGGGGGTTTGG - Exonic
915754383 1:158245090-158245112 ATTCGGAGGAACTGGGAGTTAGG - Intergenic
916179706 1:162072653-162072675 ATTACAAAGATCTGGGAGTTAGG - Intronic
918625199 1:186649497-186649519 ATTCTGAAGTTCTGGGGGTTAGG - Intergenic
919122358 1:193357003-193357025 ATTCACAAGGTCTGGGTATTAGG - Intergenic
920102069 1:203523046-203523068 ATTGGCAGGGTCTGGGAGTGAGG - Intergenic
920647489 1:207814190-207814212 ATTTCTGAGGTCTGGGAGTCAGG - Intergenic
922732978 1:227961651-227961673 ATTCTAAAGTACTGGGAGTTAGG - Intergenic
924660782 1:246014887-246014909 CTTTGGCAGGTCTGGGAGTTTGG - Intronic
1063163533 10:3438761-3438783 ATTCACAGGCTCTGGGAGTTAGG + Intergenic
1063802874 10:9601418-9601440 TTTGCTATGGTCTGGGAGTTGGG + Intergenic
1063942282 10:11142811-11142833 AGTCGTAAGGCCAGGTAGTTAGG + Intronic
1066031903 10:31436132-31436154 ATTCGCCATGTATGGGAGTTTGG + Intronic
1066454132 10:35558549-35558571 ATTCTGAGGGTCTGGGGGTTAGG - Intronic
1069197710 10:65573322-65573344 ATTCTGAAGCACTGGGAGTTAGG + Intergenic
1070308228 10:75252883-75252905 ATTCTGAAGTACTGGGAGTTAGG + Intergenic
1070916640 10:80159263-80159285 ATTCTGAAGTCCTGGGAGTTGGG - Intronic
1071068881 10:81668788-81668810 ATTCAGCAGGTCTGGGAGGTGGG + Intergenic
1072292739 10:93979619-93979641 ATTTGTTAATTCTGGGAGTTAGG - Intergenic
1073111334 10:101064657-101064679 ATTCCTGAGTTCTGGGGGTTGGG + Intronic
1074610330 10:115015470-115015492 ATTCTGAAGAACTGGGAGTTAGG + Intergenic
1079075791 11:17384829-17384851 ATAAGCAAGGTCTGGGAGGTAGG + Intergenic
1079978863 11:27127930-27127952 ATTGGCAAGGTCTGGAAATTTGG - Intergenic
1081053052 11:38370048-38370070 TTTCATGAGGTCTGGGAGTGAGG + Intergenic
1081215901 11:40397623-40397645 ATTCCTAAGGACAGAGAGTTGGG + Intronic
1081439701 11:43066413-43066435 ATTCAGAATTTCTGGGAGTTGGG - Intergenic
1083858048 11:65403507-65403529 AGTCGTGTGGTCTGTGAGTTGGG + Intronic
1086463830 11:87033567-87033589 TTACCTAAGGTCAGGGAGTTTGG + Intergenic
1087974930 11:104532933-104532955 ATTCATAGGTTCTGGGAATTAGG + Intergenic
1088004029 11:104919273-104919295 AATAGTAAGCTCTGGGATTTGGG + Intergenic
1088998650 11:115029155-115029177 ATTCACAAGCTCTGGCAGTTTGG - Intergenic
1092896666 12:13018337-13018359 ATTCATAGGCTCTGGGGGTTAGG + Intergenic
1093882895 12:24425909-24425931 TTTCATGAGGTCTGGGATTTAGG - Intergenic
1097339061 12:58417041-58417063 ATTCCTAAGTTCTGGGGTTTAGG - Intergenic
1100371098 12:93969310-93969332 ATTCACAAGTTCTGGGAATTAGG + Intergenic
1100384615 12:94094080-94094102 ATTCCCAAGGTTTTGGAGTTAGG + Intergenic
1102650960 12:114442119-114442141 ATTCTTAATGTTTGGGAGTTGGG + Intergenic
1102823638 12:115927994-115928016 ATTCGAAGGTACTGGGAGTTAGG - Intergenic
1104577242 12:129979015-129979037 ATTTCTAATGCCTGGGAGTTTGG - Intergenic
1106670843 13:31903352-31903374 CCTCCCAAGGTCTGGGAGTTTGG + Intergenic
1107216298 13:37923213-37923235 CTTCCTAAGGTTTGGGAATTGGG + Intergenic
1108103945 13:46988608-46988630 ATTCTGAAGTACTGGGAGTTAGG - Intergenic
1108681516 13:52784755-52784777 ATTCATAGGTTCTGGGAATTAGG + Intergenic
1110014200 13:70380054-70380076 ATTAGGAAGGTCTGCCAGTTGGG + Intergenic
1110355204 13:74559523-74559545 ATTCGCAGGTACTGGGAGTTCGG - Intergenic
1110523418 13:76507240-76507262 ATTTATGAGGTCTGGAAGTTTGG + Intergenic
1112086785 13:96040515-96040537 ATTCACAGGTTCTGGGAGTTAGG + Intronic
1112779185 13:102879444-102879466 ATTGGAAAGGGCTAGGAGTTGGG - Intergenic
1114613123 14:24054923-24054945 CTTCCTGAGGTCTGGGAGCTGGG - Intronic
1114792837 14:25679257-25679279 ATTCACAAGTTCTGGGAATTAGG + Intergenic
1115628565 14:35220113-35220135 ATTCACAAGTTCTGGGTGTTAGG + Intronic
1119879804 14:78091305-78091327 ATTGGTAAGGTCTGAGAAATAGG - Intergenic
1120179483 14:81329038-81329060 ATTCGTACGTTCTGGGGATTAGG - Intronic
1124926434 15:34074743-34074765 ATTCTGAAGTACTGGGAGTTAGG + Intergenic
1126399130 15:48251315-48251337 ATGCTTAAGGTTTGGAAGTTTGG + Intronic
1126641529 15:50831728-50831750 ATTCATAGGTACTGGGAGTTAGG + Intergenic
1127880106 15:63149712-63149734 ATTCGTAGGTTCTGGGGATTAGG - Exonic
1131293232 15:91125233-91125255 ATTCTGAAGTTCTGGGGGTTAGG + Intronic
1131468398 15:92673963-92673985 ATTCTGAAGTACTGGGAGTTAGG + Intronic
1133957232 16:10455139-10455161 ATTCACAAGTTCTGGGAATTAGG - Intronic
1134204499 16:12226220-12226242 ATTAATATTGTCTGGGAGTTTGG + Intronic
1134275909 16:12775980-12776002 ATTTGTAAGTTCCAGGAGTTAGG - Intronic
1137365773 16:47858297-47858319 CTTCCTAAGGTCTTGGAGTCAGG - Intergenic
1137386276 16:48045418-48045440 CTTAGTAAGGGCTGGGAATTAGG + Intergenic
1137894748 16:52199282-52199304 ATTTCAAAGTTCTGGGAGTTAGG - Intergenic
1138643465 16:58405048-58405070 ATTCCTTGTGTCTGGGAGTTTGG + Exonic
1139784318 16:69379191-69379213 ATTCTTCAGTTCTGTGAGTTTGG - Intronic
1140006412 16:71080688-71080710 ATTCATAGGTTCTGGGAATTAGG - Intronic
1141316919 16:82971143-82971165 ATTCGAAGGGTGAGGGAGTTGGG - Intronic
1143966535 17:10759565-10759587 ATGGGTAAGGTCTGGGAGGCGGG - Intergenic
1146551603 17:33785037-33785059 ATTCTGAAGCCCTGGGAGTTAGG - Intronic
1147130033 17:38402221-38402243 CTTCGTCAGGTGTGGGTGTTTGG + Exonic
1150584987 17:66509330-66509352 ATTCTGAAGGTCTGGGAGCCAGG + Intronic
1152456754 17:80421415-80421437 ACACATCAGGTCTGGGAGTTGGG + Intronic
1155172783 18:23279472-23279494 ATTCGGAGGTACTGGGAGTTAGG - Intronic
1158733482 18:60052966-60052988 ATTAATTAGGTCTGGTAGTTAGG - Intergenic
1158859182 18:61575419-61575441 ATTCTGAAGTTCTGGGAATTTGG - Intergenic
1159008996 18:63040591-63040613 ATTCTGAAGTACTGGGAGTTAGG + Intergenic
1159386822 18:67736527-67736549 AATGGTCAGGTCTTGGAGTTTGG - Intergenic
1160113878 18:76058850-76058872 ATTTATAAGTTCTGGGGGTTGGG - Intergenic
1160271839 18:77393973-77393995 ATTCGTAGGTTTTGGGAGTTAGG + Intergenic
1160470168 18:79124702-79124724 ATTCGTAAGGTTAGGGGTTTGGG + Intronic
1166625589 19:44351310-44351332 ATTCATAAGCTCTGGGAATTAGG + Intronic
1166873071 19:45882556-45882578 ATCCCTAATATCTGGGAGTTAGG + Intergenic
1168259628 19:55186134-55186156 ATCCGTAAGGTCTGGGTGTGGGG + Intronic
929055943 2:37875873-37875895 GTTCGAAAGGCCTGGGAGATAGG + Intergenic
930996222 2:57721799-57721821 ATTCGTATGGCTTAGGAGTTCGG + Intergenic
931490548 2:62741277-62741299 GTTGGAAAGGTCTGGGAGTAGGG + Intronic
932309079 2:70725434-70725456 ATTCACAGGCTCTGGGAGTTAGG - Intronic
933233475 2:79837010-79837032 ATTCGTAAGTATTGGAAGTTAGG + Intronic
933563035 2:83913060-83913082 ATTCATAGGGTCTAGGAATTAGG - Intergenic
934942096 2:98510132-98510154 ATTCCCAGGGTATGGGAGTTGGG + Intronic
943997029 2:194782364-194782386 ATTCACAAGTTCTGGGAATTGGG - Intergenic
944388933 2:199197218-199197240 ATTCTGAAGTACTGGGAGTTAGG - Intergenic
947802423 2:232938503-232938525 ATACATAGGGTCTGGGGGTTTGG + Intronic
948126645 2:235569042-235569064 ATTCATAGGTTCTGGGTGTTGGG + Intronic
1170018855 20:11813468-11813490 ATTCTGAAGTTCTGGGGGTTAGG - Intergenic
1170162591 20:13329209-13329231 ATTCTGAAGTACTGGGAGTTAGG - Intergenic
1172183418 20:33017099-33017121 ATTGGTAAGATCTGGGAGCCAGG + Exonic
1174089526 20:48035981-48036003 ATTCCTTAGGTGTGGGAGTGGGG + Intergenic
1183593626 22:38796401-38796423 CTTCGTAAGGTCTGGGTGGAGGG + Intergenic
1184493411 22:44823617-44823639 TTTAGTGAGGTCTGGGAGTGGGG - Intronic
951949658 3:28185668-28185690 ATTTGGAAGTACTGGGAGTTAGG + Intergenic
954491758 3:50913244-50913266 GTTAGTAAGGTCTGAGAGTTAGG + Intronic
955486657 3:59440889-59440911 ATTCATCATGTCTTGGAGTTGGG + Intergenic
955540916 3:59975280-59975302 CTTCATAAGGTTTGGGACTTAGG - Intronic
955598435 3:60617618-60617640 ATTGGAAAGGTCTAGGATTTTGG - Intronic
956600895 3:71021205-71021227 ATTGGCAAGGGCTGGGAGTTGGG - Intronic
956819506 3:72940827-72940849 ATTAGTCAGGTGTGGTAGTTTGG - Intronic
959362515 3:105411261-105411283 ATTCAGAAGAGCTGGGAGTTAGG + Intronic
959735948 3:109658798-109658820 ATTCCCAGGGTCTGGGGGTTGGG + Intergenic
961352876 3:126315284-126315306 ATTCTGAAGTACTGGGAGTTAGG + Intergenic
963232996 3:142927625-142927647 ATTTGGAGGTTCTGGGAGTTAGG + Intergenic
967256954 3:187603196-187603218 ATTCTAAGGTTCTGGGAGTTAGG - Intergenic
969098135 4:4749584-4749606 AGCAGTGAGGTCTGGGAGTTTGG + Intergenic
969312338 4:6361062-6361084 ATTCTGAGGTTCTGGGAGTTAGG + Intronic
969463196 4:7339703-7339725 ATTCGTAGGTCCTGGGGGTTAGG + Intronic
971264254 4:25084243-25084265 ATTCATAAGTTTTGGGAATTAGG - Intergenic
975057723 4:69956295-69956317 TTTGGTAAGTTTTGGGAGTTTGG - Exonic
976162291 4:82216160-82216182 AGTCTTAAGGTCTGCTAGTTAGG + Intergenic
976843052 4:89453861-89453883 ATTCGTCAGTACTGGGAGTTAGG + Intergenic
977110875 4:92953176-92953198 ATTCAGAGGGACTGGGAGTTAGG + Intronic
977239061 4:94544308-94544330 ATTCATATGGTCTGGGTATTGGG + Intronic
977394675 4:96455419-96455441 AGTGGTGAGGTGTGGGAGTTGGG + Intergenic
978352363 4:107833381-107833403 ATTCATAGGTTCTGGGAATTAGG - Intronic
979714724 4:123823670-123823692 ATTCAGAAGTTCTGGGAATTAGG + Intergenic
981930038 4:150179884-150179906 TTCCGTAAGGTATGGGAGATTGG + Intronic
982937453 4:161500121-161500143 ATTCCTAAGGTCTGGGAATTGGG - Exonic
985690953 5:1312015-1312037 ATTCTGAAGTTCTGGGGGTTAGG - Intergenic
986745219 5:10737791-10737813 ATTCTGAAGTACTGGGAGTTAGG - Intronic
986968776 5:13307057-13307079 ATTTGGAAGCTCTGGGAGGTCGG - Intergenic
995012246 5:107269674-107269696 ATTCATAAGTTCTGAGAGTTAGG + Intergenic
996480339 5:123968854-123968876 ACTTGTAAGGTCTGTGATTTGGG + Intergenic
998458157 5:142289712-142289734 ATTTGTCAGGCCTGGGAGCTGGG - Intergenic
998730058 5:145064577-145064599 ATTCATAAGTTCTGGGAATTAGG - Intergenic
999272686 5:150306603-150306625 ATTCCAAAAGCCTGGGAGTTTGG + Intronic
1000769898 5:165339947-165339969 GTTGGTCAGGTCTTGGAGTTTGG - Intergenic
1007545760 6:42692923-42692945 ATTCATAAGATCTGGTTGTTTGG + Exonic
1009047977 6:58250757-58250779 GTTTGTAATATCTGGGAGTTGGG + Intergenic
1009223856 6:61005519-61005541 GTTTGTAACATCTGGGAGTTGGG + Intergenic
1010504846 6:76644464-76644486 AATCATAAGGTCCAGGAGTTAGG + Intergenic
1011084445 6:83523651-83523673 ATTCAGAAAGGCTGGGAGTTGGG - Exonic
1012777561 6:103517001-103517023 ATTCTGAAGTTCTGGGGGTTAGG - Intergenic
1013889223 6:115006062-115006084 ATTCAATAGGTCTGGGAGGTGGG - Intergenic
1014265889 6:119277437-119277459 ATTTTTATGGTCTGGGAATTAGG - Intronic
1014820411 6:125982901-125982923 ATTCAGCAGGTCTGGGAGTCGGG + Intergenic
1016618041 6:146075967-146075989 ATTCATAAGTACTGGGAATTAGG + Intronic
1016872021 6:148827011-148827033 ATTCACAGGTTCTGGGAGTTAGG + Intronic
1018367833 6:163139395-163139417 ATTTATAGGTTCTGGGAGTTAGG + Intronic
1018619937 6:165720486-165720508 ATTCTTTAGGTTTGGGAGTAGGG - Intronic
1022171770 7:27838384-27838406 CTGCATGAGGTCTGGGAGTTCGG + Intronic
1024760586 7:52592227-52592249 ATACCTCAGGTTTGGGAGTTTGG - Intergenic
1024841695 7:53594208-53594230 AATCCTAATGTCTGTGAGTTGGG + Intergenic
1025620660 7:63167139-63167161 ATTCACAGGGACTGGGAGTTAGG + Intergenic
1026899122 7:74027565-74027587 ATTGGGCAGGTCTGGGGGTTTGG - Intergenic
1031672046 7:124561172-124561194 TTTCCTAAGATTTGGGAGTTGGG + Intergenic
1032895158 7:136241987-136242009 CTTCATGAGGTCTGGGAGTAAGG + Intergenic
1034350310 7:150410974-150410996 ATTCGTTAGGTCTGGGAGAAGGG - Intronic
1034672439 7:152868863-152868885 ATTCGGAGGTCCTGGGAGTTAGG + Intergenic
1035139600 7:156745084-156745106 ATTCACAAGGTCTGGGGATTAGG + Intronic
1041795172 8:61739134-61739156 ATTGATAAGGTTTGGGGGTTGGG + Intergenic
1043629360 8:82309322-82309344 ATTCTGAAGTGCTGGGAGTTAGG - Intergenic
1045023192 8:98062286-98062308 ATTCGTAGGTTCTGGGGGTTAGG - Intergenic
1046583775 8:116125874-116125896 ATTCACAAGTTCTGGGAATTAGG - Intergenic
1046912296 8:119641724-119641746 ATTCATTAGGTCTGGCAGGTGGG + Intronic
1047232222 8:123007340-123007362 ATTCATAGGTTCTGGGAATTAGG + Intergenic
1047767684 8:128002772-128002794 ATTCACAGGTTCTGGGAGTTAGG + Intergenic
1048929073 8:139296606-139296628 ATTCGAAGGGACTGGGAATTAGG - Intergenic
1049416048 8:142495818-142495840 ATTCGTAGGTTCTGGGGGTTAGG + Intronic
1050202037 9:3156006-3156028 AGTAGTAAGGTCTGGGAGTTTGG - Intergenic
1050306976 9:4314752-4314774 ATTCATTAGCTCTGGGATTTTGG + Intronic
1055087553 9:72329447-72329469 ATTCCTAAGGTGGGGGAGCTTGG + Intergenic
1056052523 9:82784313-82784335 ATTCATGAGTTCTGGGAATTAGG + Intergenic
1056184581 9:84121197-84121219 ATTCTGATGGTCTGGGGGTTGGG - Intergenic
1056765256 9:89441209-89441231 ATTCGTAAGGTCTGGGAGTTTGG - Intronic
1056935067 9:90910286-90910308 ATTCTGAGGTTCTGGGAGTTGGG + Intergenic
1057734764 9:97646063-97646085 ATTTATCAGGTCTGGGGGTTGGG - Intronic
1058949758 9:109892444-109892466 ATTCATAGGTTCTGGGGGTTAGG + Intronic
1059343182 9:113611162-113611184 ATTCTCCAGGACTGGGAGTTAGG + Intergenic
1062188773 9:135235004-135235026 ATTCTGAAGATCTGGGGGTTAGG + Intergenic
1185869588 X:3652716-3652738 ATTCTGAAGTTCTGGGGGTTAGG - Intronic
1188642768 X:32526994-32527016 ATTAGTTAAGTCTGGGAGCTTGG - Intronic
1189602706 X:42644135-42644157 AGTGGTAAGGGCTTGGAGTTGGG + Intergenic
1194532258 X:95065379-95065401 ATTCGTGAGTTCTGGGTATTAGG - Intergenic
1194743974 X:97608565-97608587 ATTCGTAGGATTTGGCAGTTAGG - Intergenic
1197086657 X:122484590-122484612 ATTGGTGAAGTCTGGGTGTTTGG - Intergenic
1197296989 X:124730859-124730881 TTTCCTAAAGTCTGGGATTTGGG - Intronic
1197524310 X:127543906-127543928 ATCCTTAATGTTTGGGAGTTTGG + Intergenic
1197557782 X:127977065-127977087 ATTCATAGGTTCTGGGAATTAGG - Intergenic
1197598481 X:128496299-128496321 ATTCATTAGGTCTGGGAATGTGG + Intergenic
1197657798 X:129136432-129136454 ATTCATAAGGCCTGGGGATTAGG + Intergenic
1197882662 X:131183919-131183941 ATTCATAGGTTCTGGGGGTTAGG + Intergenic
1198210644 X:134512593-134512615 GTTCGTAAGTGATGGGAGTTAGG + Intronic
1198709570 X:139486480-139486502 ATTCATAGGTTCTGGGGGTTAGG + Intergenic
1199262919 X:145796671-145796693 ATTCGTAGGCTCTGGGGATTAGG - Intergenic