ID: 1056765257

View in Genome Browser
Species Human (GRCh38)
Location 9:89441216-89441238
Sequence GGTTGGTATTCGTAAGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056765257_1056765265 6 Left 1056765257 9:89441216-89441238 CCCAGACCTTACGAATACCAACC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1056765265 9:89441245-89441267 CTCCGCTTCCACACACGCGCAGG No data
1056765257_1056765267 12 Left 1056765257 9:89441216-89441238 CCCAGACCTTACGAATACCAACC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1056765267 9:89441251-89441273 TTCCACACACGCGCAGGACTCGG No data
1056765257_1056765271 20 Left 1056765257 9:89441216-89441238 CCCAGACCTTACGAATACCAACC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data
1056765257_1056765269 16 Left 1056765257 9:89441216-89441238 CCCAGACCTTACGAATACCAACC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1056765269 9:89441255-89441277 ACACACGCGCAGGACTCGGCCGG No data
1056765257_1056765270 17 Left 1056765257 9:89441216-89441238 CCCAGACCTTACGAATACCAACC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056765257 Original CRISPR GGTTGGTATTCGTAAGGTCT GGG (reversed) Intronic
917274559 1:173318471-173318493 GGTAGGCATTCTTAAGGTCAAGG + Intergenic
921193804 1:212732958-212732980 TCTTGGTATTCCTCAGGTCTGGG + Intronic
1086665033 11:89469904-89469926 AGTTGTTATTCCTTAGGTCTCGG + Intronic
1087632373 11:100665434-100665456 GGCTGGTAATCCTGAGGTCTAGG - Intergenic
1088665077 11:112086338-112086360 GGCTGGCATTCGAAAGATCTGGG - Intronic
1089998284 11:122929494-122929516 GGCTGCTATTTGTATGGTCTAGG + Intronic
1097893845 12:64804858-64804880 GGTTTGTAGTCGTCAGGTGTTGG + Intronic
1100222726 12:92523533-92523555 GGATTGTATTGATAAGGTCTAGG - Intergenic
1107487398 13:40842381-40842403 GCTTGGTATTGGTCAGGTCAGGG - Intergenic
1129605652 15:77023779-77023801 GGGTGGTGTGCGTAAGGGCTGGG + Intronic
1143579970 17:7819707-7819729 GGTTGGGATTCTGCAGGTCTGGG + Intronic
1157298857 18:46465374-46465396 GGTAGATATTGATAAGGTCTGGG - Intergenic
1163050843 19:14682565-14682587 GGTTGGGATTCTTGAGGTTTTGG + Intronic
926574097 2:14561340-14561362 GTTTGGAATTCCTAAGTTCTGGG + Intergenic
926899546 2:17735592-17735614 GGTTGGTATTAGGAAGGCCAAGG + Intronic
949846966 3:8381344-8381366 GGTATGTATTTGGAAGGTCTGGG + Intergenic
955475528 3:59332531-59332553 CATTGGAATTCATAAGGTCTAGG + Intergenic
967928782 3:194674867-194674889 GGTAGATTTTCGTAACGTCTTGG - Intergenic
982937455 4:161500128-161500150 TGTTTTTATTCCTAAGGTCTGGG - Exonic
986666038 5:10105087-10105109 GTTTGGTCTTTGTAAGGCCTGGG - Intergenic
992216603 5:74530492-74530514 GGTTGGTATTCTTAATCTGTAGG + Intergenic
997675913 5:135713167-135713189 GGTTGCAATTCAGAAGGTCTGGG - Intergenic
1009465663 6:63965749-63965771 CCTTGGTATTTGTAAGATCTGGG + Intronic
1009528754 6:64782117-64782139 GGTTGGTATTCATAAGTTATTGG + Intronic
1010578313 6:77561793-77561815 GGTTGGCTTTCCTAAGGTCAGGG + Intergenic
1013650991 6:112194255-112194277 GGCTGGGAATCTTAAGGTCTGGG + Intronic
1015833169 6:137390950-137390972 AGTTGGTTTTCATAAGGTCTAGG + Intergenic
1020760032 7:12257572-12257594 GGTTCGTATTCAGTAGGTCTAGG + Intergenic
1020825870 7:13027278-13027300 AGTTGGTATATGTAAGGTCCAGG + Intergenic
1022885970 7:34643997-34644019 GGTTGGAATTGCTAAGGTCAGGG + Intergenic
1040601935 8:48893425-48893447 GGCTGGTATTCCTGATGTCTGGG - Intergenic
1042423581 8:68620341-68620363 GGTTGGCATTCAGAGGGTCTGGG + Intronic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1057070419 9:92094120-92094142 GGTTTGTATTCTTAAAGACTTGG - Intronic
1186648109 X:11528899-11528921 GGTTGGTTTTAGTAATGTTTTGG - Intronic
1190788597 X:53678453-53678475 GGTTGATATTCATAAGTACTTGG - Intronic
1191706414 X:64098803-64098825 TGTTGGTAATAGTAAGATCTAGG + Intergenic