ID: 1056765258

View in Genome Browser
Species Human (GRCh38)
Location 9:89441217-89441239
Sequence GGGTTGGTATTCGTAAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 22}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056765258_1056765269 15 Left 1056765258 9:89441217-89441239 CCAGACCTTACGAATACCAACCC 0: 1
1: 0
2: 0
3: 3
4: 22
Right 1056765269 9:89441255-89441277 ACACACGCGCAGGACTCGGCCGG No data
1056765258_1056765271 19 Left 1056765258 9:89441217-89441239 CCAGACCTTACGAATACCAACCC 0: 1
1: 0
2: 0
3: 3
4: 22
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data
1056765258_1056765270 16 Left 1056765258 9:89441217-89441239 CCAGACCTTACGAATACCAACCC 0: 1
1: 0
2: 0
3: 3
4: 22
Right 1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG No data
1056765258_1056765267 11 Left 1056765258 9:89441217-89441239 CCAGACCTTACGAATACCAACCC 0: 1
1: 0
2: 0
3: 3
4: 22
Right 1056765267 9:89441251-89441273 TTCCACACACGCGCAGGACTCGG No data
1056765258_1056765265 5 Left 1056765258 9:89441217-89441239 CCAGACCTTACGAATACCAACCC 0: 1
1: 0
2: 0
3: 3
4: 22
Right 1056765265 9:89441245-89441267 CTCCGCTTCCACACACGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056765258 Original CRISPR GGGTTGGTATTCGTAAGGTC TGG (reversed) Intronic
913439782 1:118885184-118885206 GAGTTGGTATTCCTGAGATCAGG + Exonic
1076831479 10:132996532-132996554 GGGTGGGTCTTCGTGGGGTCAGG - Intergenic
1088665078 11:112086339-112086361 GGGCTGGCATTCGAAAGATCTGG - Intronic
1090621326 11:128563588-128563610 AGGTTGTCAGTCGTAAGGTCAGG - Intronic
1107487399 13:40842382-40842404 AGCTTGGTATTGGTCAGGTCAGG - Intergenic
1120806446 14:88756121-88756143 GGGGTGGTATTCATCAAGTCAGG + Intronic
1129930209 15:79404276-79404298 TGGTTGGTCTTCTTAAGGGCTGG + Intronic
1132607252 16:798753-798775 GGGTTGTTCTTCATCAGGTCGGG + Exonic
1151628571 17:75293955-75293977 GGGTTGGTCATCTTGAGGTCAGG + Intergenic
1157298858 18:46465375-46465397 GGGTAGATATTGATAAGGTCTGG - Intergenic
925427940 2:3766412-3766434 GGGTTGGGATTCTGAAAGTCTGG - Intronic
1173019961 20:39258827-39258849 GGGTTGGTATTCTTCATCTCTGG + Intergenic
953280265 3:41548048-41548070 GGGTTGGTATCCTAAAGGGCTGG - Intronic
982937456 4:161500129-161500151 GTGTTTTTATTCCTAAGGTCTGG - Exonic
986666039 5:10105088-10105110 GGTTTGGTCTTTGTAAGGCCTGG - Intergenic
991544979 5:67771693-67771715 GGGTGGGTATTTGGGAGGTCGGG + Intergenic
991677851 5:69106474-69106496 GTGTTGGTAGTGATAAGGTCAGG - Intronic
1003329574 6:5118799-5118821 GGGTCGATATTCGTAAGTTTGGG - Intronic
1010578312 6:77561792-77561814 GGGTTGGCTTTCCTAAGGTCAGG + Intergenic
1015525672 6:134174015-134174037 GGGTTGGCATTCATAAGCTCAGG + Exonic
1022885969 7:34643996-34644018 TGGTTGGAATTGCTAAGGTCAGG + Intergenic
1034427310 7:151020844-151020866 GGGTTGGGCTTCGGAAGGGCAGG - Intronic
1042423580 8:68620340-68620362 GGGTTGGCATTCAGAGGGTCTGG + Intronic
1055663275 9:78528563-78528585 GGGTTAGTCTTCTTAAGGTCAGG + Intergenic
1056765258 9:89441217-89441239 GGGTTGGTATTCGTAAGGTCTGG - Intronic
1061149403 9:128820393-128820415 GGGTTGGTAGTTGGAAGGGCTGG + Exonic