ID: 1056765258

View in Genome Browser
Species Human (GRCh38)
Location 9:89441217-89441239
Sequence GGGTTGGTATTCGTAAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056765258_1056765270 16 Left 1056765258 9:89441217-89441239 CCAGACCTTACGAATACCAACCC No data
Right 1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG No data
1056765258_1056765267 11 Left 1056765258 9:89441217-89441239 CCAGACCTTACGAATACCAACCC No data
Right 1056765267 9:89441251-89441273 TTCCACACACGCGCAGGACTCGG No data
1056765258_1056765269 15 Left 1056765258 9:89441217-89441239 CCAGACCTTACGAATACCAACCC No data
Right 1056765269 9:89441255-89441277 ACACACGCGCAGGACTCGGCCGG No data
1056765258_1056765265 5 Left 1056765258 9:89441217-89441239 CCAGACCTTACGAATACCAACCC No data
Right 1056765265 9:89441245-89441267 CTCCGCTTCCACACACGCGCAGG No data
1056765258_1056765271 19 Left 1056765258 9:89441217-89441239 CCAGACCTTACGAATACCAACCC No data
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056765258 Original CRISPR GGGTTGGTATTCGTAAGGTC TGG (reversed) Intronic