ID: 1056765260

View in Genome Browser
Species Human (GRCh38)
Location 9:89441222-89441244
Sequence GCCAAGGGTTGGTATTCGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 31}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056765260_1056765270 11 Left 1056765260 9:89441222-89441244 CCTTACGAATACCAACCCTTGGC 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG No data
1056765260_1056765265 0 Left 1056765260 9:89441222-89441244 CCTTACGAATACCAACCCTTGGC 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1056765265 9:89441245-89441267 CTCCGCTTCCACACACGCGCAGG No data
1056765260_1056765271 14 Left 1056765260 9:89441222-89441244 CCTTACGAATACCAACCCTTGGC 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1056765271 9:89441259-89441281 ACGCGCAGGACTCGGCCGGGCGG No data
1056765260_1056765269 10 Left 1056765260 9:89441222-89441244 CCTTACGAATACCAACCCTTGGC 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1056765269 9:89441255-89441277 ACACACGCGCAGGACTCGGCCGG No data
1056765260_1056765267 6 Left 1056765260 9:89441222-89441244 CCTTACGAATACCAACCCTTGGC 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1056765267 9:89441251-89441273 TTCCACACACGCGCAGGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056765260 Original CRISPR GCCAAGGGTTGGTATTCGTA AGG (reversed) Intronic
909324309 1:74330726-74330748 GCCATAGATTGGTATTTGTAGGG - Intronic
909345532 1:74581434-74581456 GCCAACAGGTGGTATTTGTAAGG - Intronic
1063691664 10:8293342-8293364 GTCAGGGGTTTGTATTTGTAGGG - Intergenic
1082731684 11:56805885-56805907 GCCAAGGGCTGGTGTTCCTCAGG - Intergenic
1082887302 11:58100105-58100127 TCCAAGGGTTAGCATTCTTAAGG - Intronic
1096651956 12:53066246-53066268 GCAAAGGGTGGGTATTAGTGGGG - Intronic
1111340782 13:86882676-86882698 GACAAGGGTTGGTATTGATATGG - Intergenic
1131292550 15:91119148-91119170 GCAAAGGGTTGGCATTTCTAAGG + Intronic
1131559964 15:93431013-93431035 GCCAAGGCTTGGCATTGGAATGG - Intergenic
1144815981 17:18035371-18035393 GCCAAGGGATGGAAGTAGTAAGG + Intronic
1155852922 18:30794922-30794944 GCCAAGGCATGGTATTTTTATGG + Intergenic
929300235 2:40295769-40295791 GTCAAGAGTTGGTGTTAGTAGGG - Intronic
944433294 2:199659734-199659756 GCCAAGGCTTGGCATTGGAATGG + Intergenic
945620717 2:212133207-212133229 GCCAAGGGTTGTTCTCAGTAGGG - Intronic
1169970621 20:11265913-11265935 CCCAAGGGGTGCTATTTGTATGG - Intergenic
1170350774 20:15438586-15438608 ACCAAGGGTTGGCATACCTAAGG - Intronic
1177197793 21:17921018-17921040 GCCAAGGGTTTGTATTAGTCTGG + Intronic
956542455 3:70356750-70356772 GCCTGGGATTGGTATTCTTAAGG - Intergenic
957989369 3:87610370-87610392 TCCAAGGGGTGGTTTTCTTAGGG + Intergenic
968253555 3:197245455-197245477 TCCAAGGGGTGGTTTTCTTAGGG + Intronic
970094907 4:12452449-12452471 GCTAATGGTTGATATTTGTATGG - Intergenic
977172794 4:93783771-93783793 GCCAAGGGTTGGTTTTTCTAAGG - Intergenic
977490996 4:97711417-97711439 GTCAAGGGTGGGTATTTGTATGG - Intronic
994244439 5:97463498-97463520 CCCAATGTTTGGTATTCTTAAGG - Intergenic
997844047 5:137269850-137269872 GCCCAGCCTTGGTATTGGTAGGG - Intronic
1001831537 5:174793486-174793508 GCCAAGGGCTGGTCTTCATTTGG - Intergenic
1006604818 6:35248694-35248716 GCCTAGGGTTACTATTTGTAGGG - Exonic
1009461770 6:63921920-63921942 GGAAAAGGTAGGTATTCGTAAGG + Intronic
1012367126 6:98455292-98455314 GCTAAGGGTAGGTATTCCAATGG - Intergenic
1021245592 7:18257651-18257673 GCCTAGAGTTGGTATTAGGAAGG - Intronic
1025807912 7:64853153-64853175 GCCAAGGCTTGGCATTGGAATGG - Intergenic
1038538752 8:28373732-28373754 GGGAAGGGTTGGTATTGGGAAGG - Intronic
1056765260 9:89441222-89441244 GCCAAGGGTTGGTATTCGTAAGG - Intronic
1058812477 9:108654481-108654503 GCCAAGAATTGGTATGAGTATGG - Intergenic
1059356530 9:113703745-113703767 ACCAAGGGTTAGTATCCATAAGG + Intergenic
1195750287 X:108157298-108157320 GCCAAGGGTTGGTGTGGGGAGGG + Intronic